or
or
Exact

Results for "LOC643542"

Variant Events: 54

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LOC643542    2-1272-003chr18:
66330135-66330135
TCintergenicDe novo--Yuen2016 G
LOC643542    1-0043-003chr18:
66310544-66310544
GTintergenicDe novo--Yuen2017 G
LOC643542    AU3955303 Complex Event; expand row to view variants  De novo--Yuen2017 G
Yuen2017 G
LOC643542    1-0121-003chr18:
66225593-66225593
AGintergenicDe novo--Yuen2017 G
LOC643542    7-0251-003chr18:
65563460-65563460
CAncRNA_intronicDe novo--Yuen2017 G
LOC643542    2-0149-004chr18:
65971346-65971346
GAintergenicDe novo--Yuen2017 G
LOC643542    AU0039303chr18:
65187037-65187037
AGncRNA_intronicDe novo--Yuen2017 G
LOC643542    1-0346-004chr18:
65867491-65867491
AGintergenicDe novo--Yuen2017 G
LOC643542    1-0232-004chr18:
65733327-65733327
GGTTTTTTTintergenicDe novo--Yuen2017 G
LOC643542    1-0303-004chr18:
65901918-65901918
TCintergenicDe novo--Yuen2017 G
LOC643542    AU2109301chr18:
65511025-65511025
ATncRNA_intronicDe novo--Yuen2017 G
LOC643542    2-0242-003chr18:
65859248-65859248
TGintergenicDe novo--Yuen2017 G
LOC643542    2-1182-003chr18:
65285682-65285682
TCncRNA_intronicDe novo--Yuen2016 G
Yuen2017 G
LOC643542    1-0079-008chr18:
65415350-65415350
TCncRNA_intronicDe novo--Yuen2017 G
LOC643542    2-1416-003chr18:
65979570-65979570
GAintergenicDe novo--Yuen2017 G
LOC643542    2-1350-003chr18:
65915894-65915894
AACTintergenicDe novo--Yuen2017 G
LOC643542    1-0436-003chr18:
65443738-65443738
GCncRNA_intronicDe novo--Yuen2016 G
Yuen2017 G
LOC643542    AU2950302chr18:
65271859-65271859
TCncRNA_intronicDe novo--Yuen2017 G
LOC643542    1-0286-004chr18:
65197566-65197566
GAncRNA_intronicDe novo--Yuen2017 G
LOC643542    7-0249-004chr18:
66285175-66285175
CTintergenicDe novo--Yuen2017 G
LOC643542    1-0383-003chr18:
65736083-65736083
AGintergenicDe novo--Yuen2017 G
LOC643542    2-0285-004chr18:
66250492-66250492
CAintergenicDe novo--Yuen2017 G
LOC643542    AU076704chr18:
65552622-65552622
AGncRNA_intronicDe novo--Yuen2017 G
LOC643542    AU3937301chr18:
65202095-65202095
CTncRNA_intronicDe novo--Yuen2017 G
LOC643542    AU2333302chr18:
65254524-65254524
AGncRNA_intronicDe novo--Yuen2017 G
LOC643542    63-449chr18:
65936701-65936701
TCintergenicDe novo--Michaelson2012 G
LOC643542    2-1235-003chr18:
66279578-66279578
GAintergenicDe novo--Yuen2017 G
LOC643542    74-0352chr18:
65688496-65688496
GAintergenicDe novo--Michaelson2012 G
LOC643542    AU4188302chr18:
65353113-65353113
CTncRNA_intronicDe novo--Yuen2017 G
LOC643542    AU043804chr18:
66166147-66166147
TAintergenicDe novo--Yuen2017 G
LOC643542    AU4235302chr18:
66291446-66291446
GAintergenicDe novo--Yuen2017 G
LOC643542    1-0007-003chr18:
66278876-66278892
CAGAGAGAGAGAGAGAGCAGAGAGAGAGAGAGintergenicDe novo--Yuen2017 G
LOC643542    AU4392302chr18:
65515796-65515796
CTncRNA_intronicDe novo--Yuen2017 G
LOC643542    2-0158-003chr18:
65668340-65668340
GAintergenicDe novo--Yuen2017 G
LOC643542    2-1619-003chr18:
65682467-65682467
TCintergenicDe novo--Yuen2017 G
LOC643542    AU3862305chr18:
65485261-65485272
GCTATTATTTAAGncRNA_intronicDe novo--Yuen2017 G
LOC643542    AU4024303chr18:
65330428-65330428
TCncRNA_intronicDe novo--Yuen2017 G
LOC643542    2-1266-003chr18:
66325763-66325763
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC643542    1-0590-003chr18:
66235913-66235927
GTATATATATATATAGTATATATATATAintergenicDe novo--Yuen2017 G
LOC643542    2-0285-003chr18:
66316578-66316578
CTintergenicDe novo--Yuen2017 G
LOC643542    AU3903302chr18:
65544421-65544421
AGncRNA_intronicDe novo--Yuen2017 G
LOC643542    1-0357-003chr18:
65608807-65608807
CTintergenicDe novo--Yuen2017 G
LOC643542    1-0720-003chr18:
65730289-65730289
TCintergenicDe novo--Yuen2017 G
LOC643542    5-0042-003chr18:
66084426-66084426
TGintergenicDe novo--Yuen2017 G
LOC643542    AU003405chr18:
65579293-65579293
AGintergenicDe novo--Yuen2017 G
LOC643542    A13chr18:
65796995-65796995
CTintergenicDe novo--Wu2018 G
LOC643542    1-0138-003chr18:
66088975-66088975
CTintergenicDe novo--Yuen2017 G
LOC643542    2-1461-003chr18:
65488854-65488854
CTncRNA_intronicDe novo--Yuen2016 G
LOC643542    AU4372309chr18:
65188815-65188815
TGncRNA_intronicDe novo--Yuen2017 G
LOC643542    1-0464-003chr18:
65945535-65945535
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC643542    AU3912303chr18:
65307990-65307990
CTncRNA_intronicDe novo--Yuen2017 G
LOC643542    2-1375-003chr18:
65947208-65947208
CTintergenicDe novo--Yuen2017 G
LOC643542    2-1112-003chr18:
65343419-65343419
TCncRNA_intronicDe novo--Yuen2016 G
Yuen2017 G
LOC643542    2-1416-004chr18:
65979570-65979570
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More