or
or
Exact

Results for "ATXN8OS"

Variant Events: 51

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ATXN8OS   12493.p1chr13:
70878489-70878489
CTintergenicDe novo--Turner2016 G
ATXN8OS   5-0137-003chr13:
71457435-71457435
TGintergenicDe novo--Yuen2017 G
ATXN8OS   13023.p1chr13:
70778274-70778274
CAintergenicDe novo--Turner2016 G
ATXN8OS   1-0324-003chr13:
71009739-71009739
TCintergenicDe novo--Yuen2017 G
ATXN8OS   AU4223302chr13:
70894234-70894234
AGintergenicDe novo--Yuen2017 G
ATXN8OS   1-0225-003chr13:
70824981-70824986
TCTTTCTintergenicDe novo--Yuen2017 G
ATXN8OS   1-0991-003chr13:
71066027-71066027
GAintergenicDe novo--Yuen2017 G
ATXN8OS   2-1382-003chr13:
71421656-71421656
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
ATXN8OS   AU2129301chr13:
71165023-71165023
CAintergenicDe novo--Yuen2017 G
ATXN8OS   1-0906-003chr13:
70812618-70812618
GAintergenicDe novo--Yuen2017 G
ATXN8OS   2-1526-004chr13:
71491014-71491014
TAintergenicDe novo--Yuen2017 G
ATXN8OS   AU054103chr13:
71120168-71120168
GCintergenicDe novo--Yuen2017 G
ATXN8OS   1-0522-003chr13:
71402472-71402485
GTATATATATATATGTATATATATATintergenicDe novo--Yuen2017 G
ATXN8OS   AU046706chr13:
71576711-71576712
AGAGGintergenicDe novo--Yuen2017 G
ATXN8OS   AU3806304chr13:
70812413-70812413
CTintergenicDe novo--Yuen2017 G
ATXN8OS   2-1167-003chr13:
71526192-71526192
TGintergenicDe novo--Yuen2017 G
ATXN8OS   7-0044-003chr13:
71120961-71120961
GAintergenicDe novo--Yuen2017 G
ATXN8OS   1-0402-004chr13:
71583154-71583154
CGintergenicDe novo--Yuen2017 G
ATXN8OS   2-0057-003chr13:
71220370-71220370
CTintergenicDe novo--Yuen2017 G
ATXN8OS   AU2248302chr13:
71064727-71064727
CTintergenicDe novo--Yuen2017 G
ATXN8OS   1-0255-003chr13:
71402472-71402485
GTATATATATATATGTATATATATATintergenicDe novo--Yuen2017 G
ATXN8OS   2-1277-004chr13:
70745738-70745738
CTintergenicDe novo--Yuen2017 G
ATXN8OS   AU4376301chr13:
71478943-71478943
TCintergenicDe novo--Yuen2017 G
ATXN8OS   7-0254-004chr13:
71417172-71417172
GAintergenicDe novo--Yuen2017 G
ATXN8OS   AU3840302chr13:
70875696-70875696
ACintergenicDe novo--Yuen2017 G
ATXN8OS   AU4452302chr13:
71429855-71429855
ACintergenicDe novo--Yuen2017 G
ATXN8OS   1-0210-004chr13:
71529352-71529352
ACintergenicDe novo--Yuen2017 G
ATXN8OS   AU3964302chr13:
71418797-71418797
GAintergenicDe novo--Yuen2017 G
ATXN8OS   2-1237-003chr13:
70735564-70735564
CAintergenicDe novo--Yuen2017 G
ATXN8OS   7-0002-003chr13:
71093845-71093845
CTintergenicDe novo--Yuen2017 G
ATXN8OS   AU002903chr13:
71569161-71569161
GAintergenicDe novo--Yuen2017 G
ATXN8OS   1-0233-004chr13:
71305598-71305598
CTintergenicDe novo--Yuen2017 G
ATXN8OS   1-0300-003chr13:
70861998-70861998
CAintergenicDe novo--Yuen2017 G
ATXN8OS   AU4444304chr13:
71255997-71255997
GTintergenicDe novo--Yuen2017 G
ATXN8OS   60-2027chr13:
71205121-71205121
TCintergenicDe novo--Michaelson2012 G
ATXN8OS   2-1250-003chr13:
70727564-70727564
GAintergenicDe novo--Yuen2017 G
ATXN8OS   AU2023302chr13:
71084722-71084722
ACintergenicDe novo--Yuen2017 G
ATXN8OS   1-0433-004chr13:
71256709-71256710
ATAintergenicDe novo--Yuen2017 G
ATXN8OS   1-0214-003chr13:
70927426-70927426
TAintergenicDe novo--Yuen2017 G
ATXN8OS   1-0479-006chr13:
71133361-71133364
TATATintergenicDe novo--Yuen2017 G
ATXN8OS   AU030104chr13:
71258307-71258307
ACintergenicDe novo--Yuen2017 G
ATXN8OS   AU3692302chr13:
71260816-71260816
GAintergenicDe novo--Yuen2017 G
ATXN8OS   2-0307-004chr13:
70889572-70889572
CTintergenicDe novo--Yuen2017 G
ATXN8OS   AU4243302chr13:
71349481-71349481
CGintergenicDe novo--Yuen2017 G
ATXN8OS   1-0585-003chr13:
70739885-70739885
CAintergenicDe novo--Yuen2017 G
ATXN8OS   1-0507-003chr13:
71402472-71402485
GTATATATATATATGTATATATATATintergenicDe novo--Yuen2017 G
ATXN8OS   2-1230-003chr13:
70910136-70910136
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
ATXN8OS   2-0033-003chr13:
71232785-71232785
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
ATXN8OS   AU030103chr13:
71258307-71258307
ACintergenicDe novo--Yuen2017 G
ATXN8OS   2-1444-003chr13:
70766010-70766010
AGintergenicDe novo--Yuen2017 G
ATXN8OS   AU046904chr13:
71073523-71073523
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More