or
or
Exact

Results for "ROCK1"

Variant Events: 12

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ROCK1     11599.p1chr18:
18572849-18572849
GAexonicDe novosynonymous SNVNM_005406c.C1935Tp.L645L-1.653E-5Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
O’Roak2012b E
Satterstrom2020 E
Wilfert2021 G
ROCK1     2-1407-003chr18:
18645455-18645455
CAintronicDe novo--Yuen2016 G
Yuen2017 G
ROCK1     AU2787302chr18:
18562717-18562723
CACTTACCACsplicingDe novosplicing--Yuen2017 G
ROCK1     74-0265chr18:
18566957-18566957
TCexonicDe novononsynonymous SNVNM_005406c.A2258Gp.Q753R27.6-Michaelson2012 G
ROCK1     1-0757-003chr18:
18682062-18682062
CTintronicDe novo--Yuen2017 G
ROCK1     AU1933301chr18:
18752136-18752136
GAintergenicDe novo--Yuen2017 G
ROCK1     DEASD_1042_001chr18:
18587990-18587990
TCintronicDe novo--Satterstrom2020 E
ROCK1     1-0248-003chr18:
18795093-18795093
AGintergenicDe novo--Yuen2017 G
ROCK1     1-0290-003chr18:
18768555-18768555
TCintergenicDe novo--Yuen2017 G
ROCK1     5-0004-003chr18:
18658500-18658530
ATGGAGTTTGAGCTCTGGGACCCATCAGTCCAintronicDe novo--Yuen2017 G
ROCK1     7-0194-003chr18:
18770145-18770145
GAintergenicDe novo--Yuen2017 G
ROCK1     Lim2017:5426chr18:
18572849-18572849
GAexonicDe novosynonymous SNVNM_005406c.C1935Tp.L645L-1.653E-5Lim2017 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More