or
or
Exact

Results for "RAD51B"

Variant Events: 44

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
RAD51B     1-0582-003chr14:
68542550-68542550
GTintronicDe novo--Yuen2017 G
RAD51B     AU3263302chr14:
68774354-68774354
CTintronicDe novo--Yuen2017 G
RAD51B     5-0117-003chr14:
68879655-68879655
AGintronicDe novo--Yuen2017 G
RAD51B     7-0167-003chr14:
68601353-68601353
AGintronicDe novo--Yuen2017 G
RAD51B     AU3846303chr14:
68794711-68794711
TCintronicDe novo--Yuen2017 G
RAD51B     2-0090-003chr14:
68609055-68609055
TCintronicDe novo--Yuen2017 G
RAD51B     2-1562-004chr14:
68507924-68507924
CGintronicDe novo--Yuen2017 G
RAD51B     1-0433-003chr14:
68710201-68710201
CTintronicDe novo--Yuen2017 G
RAD51B     1-0489-003chr14:
69013864-69013864
GAintronicDe novo--Yuen2016 G
Yuen2017 G
RAD51B     1-0995-003chr14:
68799013-68799028
TACACACACACACACATACACACACACACAintronicDe novo--Yuen2017 G
RAD51B     1-0255-003chr14:
69105380-69105380
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
RAD51B     2-1411-003chr14:
68727079-68727079
TGintronicDe novo--Yuen2016 G
RAD51B     5-0077-004chr14:
68823563-68823563
GAintronicDe novo--Yuen2017 G
RAD51B     DEASD_1032_001chr14:
69078011-69078011
CAintergenicDe novo--Satterstrom2020 E
RAD51B     3-0661-000chr14:
69199806-69199806
GTintergenicDe novo--Yuen2017 G
RAD51B     AU070007chr14:
68699855-68699855
GAintronicDe novo--Yuen2017 G
RAD51B     1-0568-003chr14:
68904450-68904450
GAintronicDe novo--Yuen2017 G
RAD51B     7-0024-005chr14:
68972957-68972957
ACintronicDe novo--Yuen2017 G
RAD51B     AU3915301chr14:
69040037-69040037
TCintronicDe novo--Yuen2017 G
RAD51B     74-0688chr14:
68661217-68661217
CTintronicDe novo--Michaelson2012 G
RAD51B     2-1164-003chr14:
68832257-68832257
CTintronicDe novo--Yuen2016 G
Yuen2017 G
RAD51B     2-1370-003chr14:
68903925-68903925
GAintronicDe novo--Yuen2016 G
Yuen2017 G
RAD51B     AU050403chr14:
68475650-68475650
CTintronicDe novo--Yuen2017 G
RAD51B     1-0279-004chr14:
68428810-68428810
AGintronicDe novo--Yuen2017 G
RAD51B     3-0428-000chr14:
68859674-68859674
GAintronicDe novo--Yuen2016 G
Yuen2017 G
RAD51B     1-0126-003chr14:
68697075-68697075
CTintronicDe novo--Yuen2017 G
RAD51B     1-0609-003chr14:
68533391-68533391
CAintronicDe novo--Yuen2017 G
RAD51B     AU4410302chr14:
68903881-68903881
GAintronicDe novo--Yuen2017 G
RAD51B     AU3808304chr14:
68633689-68633689
CTintronicDe novo--Yuen2017 G
RAD51B     5-0026-003chr14:
68626307-68626307
AGintronicDe novo--Yuen2017 G
RAD51B     1-0144-005chr14:
69068518-69068518
TGintergenicDe novo--Yuen2017 G
RAD51B     AU079204chr14:
68524031-68524031
CTintronicDe novo--Yuen2017 G
RAD51B     2-1521-003chr14:
68353757-68353757
GAexonicDe novononsynonymous SNVNM_002877
NM_133509
NM_133510
c.G592A
c.G592A
c.G592A
p.E198K
p.E198K
p.E198K
15.04-Yuen2017 G
RAD51B     AU3343301chr14:
68399823-68399823
GAintronicDe novo--Yuen2017 G
RAD51B     2-1477-003chr14:
68871859-68871859
TCintronicDe novo--Yuen2016 G
Yuen2017 G
RAD51B     1-0744-003chr14:
68385709-68385709
AGintronicDe novo--Yuen2017 G
RAD51B     AU2156303chr14:
68369854-68369854
CGintronicDe novo--Yuen2017 G
RAD51B     AU3053301chr14:
68774362-68774365
GCTCGCintronicDe novo--Yuen2017 G
RAD51B     2-0295-004chr14:
68625275-68625275
CTintronicDe novo--Yuen2017 G
RAD51B     2-1451-004chr14:
68745487-68745487
TCintronicDe novo--Yuen2017 G
RAD51B     2-1327-004chr14:
68702541-68702541
GCintronicDe novo--Yuen2017 G
RAD51B     A23chr14:
68755612-68755612
TCintronicDe novo--Wu2018 G
RAD51B     2-0012-004chr14:
69205515-69205515
CCTCCAATCCCTCTGTGCCCCACCTTCAGTGCTintergenicDe novo--Yuen2017 G
RAD51B     7-0249-003chr14:
69213949-69213949
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More