or
or
Exact

Results for "CELF4"

Variant Events: 38

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CELF4     2-1715-003chr18:
34864003-34864003
CCAintronicDe novo--Yuen2017 G
CELF4     1-0826-003chr18:
34987927-34987927
AGintronicDe novo--Yuen2017 G
CELF4     1-0652-004chr18:
34967430-34967430
AGintronicDe novo--Yuen2017 G
CELF4     AU4336301chr18:
34844563-34844563
CTintronicDe novo--Yuen2017 G
CELF4     Mahjani2021:142chr18:
34855146-34855146
CAexonicnonsynonymous SNVNM_001025087
NM_001025088
NM_001025089
NM_020180
c.G509T
c.G506T
c.G479T
c.G509T
p.R170L
p.R169L
p.R160L
p.R170L
20.48.38E-6Mahjani2021 E
CELF4     2-1644-004chr18:
34863893-34863893
CCACTGintronicDe novo--Yuen2017 G
CELF4     SSC11202chr18:
34855162-34855162
CAexonicDe novostopgainNM_001025087
NM_001025088
NM_001025089
NM_020180
c.G493T
c.G490T
c.G463T
c.G493T
p.E165X
p.E164X
p.E155X
p.E165X
40.0-Lim2017 E
CELF4     AU079605chr18:
35032785-35032785
GAintronicDe novo--Yuen2017 G
CELF4     A11chr18:
34991296-34991296
CTintronicDe novo--Wu2018 G
CELF4     AU4067301chr18:
34972944-34972946
CCTCintronicDe novo--Yuen2017 G
CELF4     1-0007-003chr18:
34854815-34854815
CGexonicDe novononsynonymous SNVNM_001025087
NM_001025088
NM_001025089
NM_020180
c.G610C
c.G607C
c.G580C
c.G610C
p.E204Q
p.E203Q
p.E194Q
p.E204Q
22.2-Yuen2017 G
CELF4     AU3397302chr18:
35194548-35194548
CTintergenicDe novo--Yuen2017 G
CELF4     2-1339-003chr18:
34863975-34863975
ACintronicDe novo--Yuen2017 G
CELF4     2-0286-004chr18:
35067388-35067388
CTintronicDe novo--Yuen2017 G
CELF4     14214.p1chr18:
34855162-34855162
CAexonicDe novostopgainNM_001025087
NM_001025088
NM_001025089
NM_020180
c.G493T
c.G490T
c.G463T
c.G493T
p.E165X
p.E164X
p.E155X
p.E165X
40.0-Ji2016 E
Krumm2015 E
Satterstrom2020 E
Wilfert2021 G
CELF4     1-0541-004chr18:
34863893-34863893
CCACACACACTGintronicDe novo--Yuen2017 G
CELF4     1-0303-004chr18:
34863905-34863905
CCACACACAACATAintronicDe novo--Yuen2017 G
CELF4     AU072504chr18:
34888581-34888581
AGintronicDe novo--Yuen2017 G
CELF4     1-0677-003chr18:
34844729-34844729
CTintronicDe novo--Yuen2017 G
CELF4     1-0144-004chr18:
34863893-34863893
CCACACACACTGintronicDe novo--Yuen2017 G
CELF4     7-0191-003chr18:
34863926-34863926
CCACATACACACACCAAintronicDe novo--Yuen2017 G
CELF4     08C74427chr18:
34844598-34844598
GCintronicDe novo--Satterstrom2020 E
CELF4     1-0184-003chr18:
35009271-35009286
CTGTGTGTGTGTGTGTCTGTGTGTGTGTGTintronicDe novo--Yuen2017 G
CELF4     2-0144-004chr18:
34863912-34863912
TTACACACAACATACACACATATACACATACintronicDe novo--Yuen2017 G
CELF4     AU3786301chr18:
34914809-34914809
AGintronicDe novo--Yuen2017 G
CELF4     1-0112-004chr18:
34884002-34884002
AGintronicDe novo--Yuen2017 G
CELF4     EGAN00001101315chr18:
34839080-34839080
CTintronicDe novo--Satterstrom2020 E
CELF4     1-0054-004chr18:
35195983-35195983
TCintergenicDe novo--Yuen2017 G
CELF4     1-0882-003chr18:
35227611-35227611
GAintergenicDe novo--Yuen2017 G
CELF4     1-0338-005chr18:
35095862-35095862
GAintronicDe novo--Yuen2017 G
CELF4     G01-GEA-111-HIchr18:
34846529-34846529
GAexonicDe novostopgainNM_001025087
NM_001025088
NM_001025089
NM_020180
c.C1129T
c.C1126T
c.C1102T
c.C1132T
p.Q377X
p.Q376X
p.Q368X
p.Q378X
41.0-Lim2017 E
Satterstrom2020 E
CELF4     63-343chr18:
35094644-35094644
GAintronicDe novo--Michaelson2012 G
CELF4     ASC_CA_59_Achr18:
34854331-34854331
CAexonicDe novononsynonymous SNVNM_001025087
NM_001025088
NM_001025089
NM_020180
c.G744T
c.G741T
c.G714T
c.G744T
p.M248I
p.M247I
p.M238I
p.M248I
19.45-Satterstrom2020 E
CELF4     iHART1776chr18:
34846538-34846538
GCexonicDe novononsynonymous SNVNM_001025087
NM_001025088
NM_001025089
NM_020180
c.C1120G
c.C1117G
c.C1093G
c.C1123G
p.P374A
p.P373A
p.P365A
p.P375A
15.25-Ruzzo2019 G
CELF4     2-0319-004chr18:
35029123-35029123
TCintronicDe novo--Yuen2017 G
CELF4     AU2293301chr18:
35034819-35034819
GAintronicDe novo--Yuen2017 G
CELF4     AU071703chr18:
34827652-34827652
ATintronicDe novo--Yuen2017 G
CELF4     AU066404chr18:
34922481-34922481
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More