or
or
Exact

Results for "MCTP2"

Variant Events: 33

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MCTP2     AU2495301chr15:
95002396-95002396
CTintronicDe novo--Yuen2017 G
MCTP2     2-1357-004chr15:
95054705-95054705
GCintergenicDe novo--Yuen2017 G
MCTP2     AU3692301chr15:
95104146-95104146
CTintergenicDe novo--Yuen2017 G
MCTP2     1-0373-003chr15:
95020836-95020836
AGintronicDe novo--Yuen2017 G
MCTP2     3-0185-000chr15:
95165929-95165929
AGintergenicDe novo--Yuen2017 G
MCTP2     AU024104chr15:
95195056-95195056
AGintergenicDe novo--Yuen2017 G
MCTP2     1-0590-003chr15:
95152447-95152447
GTintergenicDe novo--Yuen2017 G
MCTP2     AU3912302chr15:
95159252-95159252
GAintergenicDe novo--Yuen2017 G
MCTP2     AU027506chr15:
95283609-95283609
TGintergenicDe novo--Yuen2017 G
MCTP2     AU027506chr15:
95384868-95384868
TCintergenicDe novo--Yuen2017 G
MCTP2     1-0862-003chr15:
94889381-94889383
CAGCintronicDe novo--Yuen2017 G
MCTP2     2-0068-003chr15:
94923337-94923337
CTintronicDe novo--Yuen2017 G
MCTP2     AU3122301chr15:
94889495-94889495
AGintronicDe novo--Yuen2017 G
MCTP2     1-0489-003chr15:
95175272-95175272
CTintergenicDe novo--Yuen2017 G
MCTP2     2-1129-003chr15:
95305830-95305830
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
MCTP2     1-0906-003chr15:
95060660-95060660
AGintergenicDe novo--Yuen2017 G
MCTP2     3-0065-000chr15:
94886247-94886259
CTATATATATATACTATATATATATATAintronicDe novo--Yuen2017 G
MCTP2     1-0912-003chr15:
94964914-94964914
TGintronicDe novo--Yuen2017 G
MCTP2     AU006804chr15:
94977361-94977361
CGintronicDe novo--Yuen2017 G
MCTP2     1-0073-003chr15:
95160267-95160267
AGintergenicDe novo--Yuen2017 G
MCTP2     11214.p1chr15:
94841642-94841642
CGexonicDe novononsynonymous SNVNM_001159643
NM_018349
c.C148G
c.C148G
p.L50V
p.L50V
7.593-Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
MCTP2     2-1428-003chr15:
95200947-95200948
TGTintergenicDe novo--Yuen2016 G
Yuen2017 G
MCTP2     AU3874303chr15:
95239654-95239654
GAintergenicDe novo--Yuen2017 G
MCTP2     2-0145-003chr15:
95215038-95215038
GAintergenicDe novo--Yuen2017 G
MCTP2     AU046707chr15:
95274880-95274880
TAintergenicDe novo--Yuen2017 G
MCTP2     AU3874303chr15:
95305241-95305241
CTintergenicDe novo--Yuen2017 G
MCTP2     7-0273-003chr15:
94999278-94999278
ACintronicDe novo--Yuen2017 G
MCTP2     iHART2768chr15:
94927292-94927292
CTexonicMaternalstopgainNM_001159644
NM_001159643
NM_018349
c.C388T
c.C1624T
c.C1624T
p.R130X
p.R542X
p.R542X
39.02.0E-4Ruzzo2019 G
MCTP2     2-1107-003chr15:
95265623-95265623
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
MCTP2     2-1246-003chr15:
95067407-95067407
GGCintergenicDe novo--Yuen2017 G
MCTP2     1-0558-003chr15:
95278622-95278628
CCTTCTTCCTTintergenicDe novo--Yuen2017 G
MCTP2     AU3955303chr15:
95264285-95264285
CTintergenicDe novo--Yuen2017 G
MCTP2     74-0075chr15:
95135361-95135361
TCintergenicDe novo--Michaelson2012 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More