or
or
Exact

Results for "ZNF532"

Variant Events: 13

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ZNF532     MT_28chr18:
56587446-56587446
GAexonicMaternalnonsynonymous SNVNM_018181c.G1927Ap.E643K16.98-Toma2013 E
ZNF532     AU3911301chr18:
56583619-56583619
CTintronicDe novo--Yuen2017 G
ZNF532     3-0458-000chr18:
56623235-56623235
TCintronicDe novo--Yuen2016 G
ZNF532     2-0309-005chr18:
56646604-56646604
ATintronicDe novo--Yuen2017 G
ZNF532     AU3721301chr18:
56640582-56640582
GAintronicDe novo--Yuen2017 G
ZNF532     3-0065-000chr18:
56577881-56577895
TAGAGAGAGAGAGAGTAGAGAGAGAGAGintronicDe novo--Yuen2017 G
ZNF532     74-0075chr18:
56585011-56585011
CAintronicDe novo--Michaelson2012 G
ZNF532     1-0627-005chr18:
56635960-56635960
TCintronicDe novo--Yuen2017 G
ZNF532     AU058105chr18:
56672848-56672848
GAintergenicDe novo--Yuen2017 G
ZNF532     1-0282-003chr18:
56670372-56670372
CTintergenicDe novo--Yuen2017 G
ZNF532     12956.p1chr18:
56585676-56585676
GAexonicDe novononsynonymous SNVNM_018181c.G157Ap.A53T3.915-Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
ZNF532     AU066404chr18:
56541119-56541119
GAintronicDe novo--Yuen2017 G
ZNF532     2-0214-003chr18:
56607805-56607805
GCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More