or
or
Exact

Results for "PEPD"

Variant Events: 19

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PEPD     1-0405-003chr19:
33998461-33998461
GAintronicDe novo--Yuen2017 G
PEPD     iHART2816chr19:
33954967-33954967
GAexonicMaternalstopgainNM_001166057
NM_000285
c.C358T
c.C550T
p.R120X
p.R184X
38.04.491E-5Ruzzo2019 G
PEPD     iHART2815chr19:
33954967-33954967
GAexonicMaternalstopgainNM_001166057
NM_000285
c.C358T
c.C550T
p.R120X
p.R184X
38.04.491E-5Ruzzo2019 G
PEPD     1-0862-003chr19:
33954991-33954991
CTintronicDe novo--Yuen2017 G
PEPD     2-1254-003chr19:
33934785-33934799
GCACACACACACACAGCACACACACACAintronicDe novo--Yuen2017 G
PEPD     63-449chr19:
34109547-34109547
TCintergenicUnknown--Michaelson2012 G
PEPD     12704.p1chr19:
34003589-34003589
GAexonicDe novosynonymous SNVNM_000285
NM_001166056
NM_001166057
c.C111T
c.C111T
c.C111T
p.N37N
p.N37N
p.N37N
--Krumm2015 E
Satterstrom2020 E
PEPD     1-0272-004chr19:
33880414-33880414
ACintronicDe novo--Yuen2017 G
PEPD     2-1327-004chr19:
34060209-34060209
CTintergenicDe novo--Yuen2017 G
PEPD     AU054303chr19:
34056714-34056742
AAAAACAAAACAAAACAAAACAAAACAAAAAAAACAAAACAAAACAAAACAAAACAAAACAAAintergenicDe novo--Yuen2017 G
PEPD     14181.p1chr19:
33892654-33892654
GAexonicDe novononsynonymous SNVNM_001166056
NM_001166057
NM_000285
c.C817T
c.C748T
c.C940T
p.R273C
p.R250C
p.R314C
14.665.981E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
PEPD     1-0452-003chr19:
33934785-33934799
GCACACACACACACAGCACACACACACAintronicDe novo--Yuen2017 G
PEPD     2-0198-004chr19:
33949739-33949739
GGTGTGTintronicDe novo--Yuen2017 G
PEPD     1-0222-003chr19:
34005531-34005531
GTintronicDe novo--Yuen2017 G
PEPD     1-0514-003chr19:
33997906-33997906
CGintronicDe novo--Yuen2016 G
Yuen2017 G
PEPD     5-0117-003chr19:
33910310-33910310
CAintronicDe novo--Yuen2017 G
PEPD     1-0412-003chr19:
33920504-33920504
TCintronicDe novo--Yuen2017 G
PEPD     AU3911302chr19:
34110977-34110977
GTintergenicDe novo--Yuen2017 G
PEPD     1-0522-003chr19:
33944144-33944144
TGintronicDe novo--Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More