or
or
Exact

Results for "WWOX"

Variant Events: 165

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
WWOX     AU2569301chr16:
79040927-79040927
GCintronicDe novo--Yuen2017 G
WWOX     12937.p1chr16:
78441213-78441213
CGintronicDe novo--Wilfert2021 G
WWOX     2-1261-003chr16:
79604557-79604557
GAintergenicDe novo--Yuen2017 G
WWOX     2-1313-003chr16:
79037664-79037664
CGintronicDe novo--Yuen2017 G
WWOX     2-1297-004chr16:
78792011-78792011
AAATintronicDe novo--Yuen2017 G
WWOX     1-0885-003chr16:
79027051-79027051
AGintronicDe novo--Yuen2017 G
WWOX     2-0289-003chr16:
78692921-78692921
AGintronicDe novo--Yuen2017 G
WWOX     AU066104chr16:
78604634-78604634
ACintronicDe novo--Yuen2017 G
WWOX     1-0079-008chr16:
78692834-78692834
CCAintronicDe novo--Yuen2017 G
WWOX     1-0606-003chr16:
78394924-78394924
TCintronicDe novo--Yuen2017 G
WWOX     AU2117302chr16:
78285595-78285595
ATintronicDe novo--Yuen2017 G
WWOX     2-1430-003chr16:
79446516-79446516
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
WWOX     AU3865301chr16:
78497091-78497091
AGintronicDe novo--Yuen2017 G
WWOX     12680.p1chr16:
78379641-78379641
TCintronicDe novo--Turner2016 G
WWOX     PN400434chr16:
78149000-78149000
CTexonicUnknownnonsynonymous SNVNM_001291997
NM_016373
NM_130791
c.C19T
c.C358T
c.C358T
p.R7W
p.R120W
p.R120W
22.60.0076Leblond2019 E
WWOX     2-1210-003chr16:
78692980-78692980
ACintronicDe novo--Yuen2017 G
WWOX     7-0024-005chr16:
78654945-78654945
GCintronicDe novo--Yuen2017 G
WWOX     AU4242302chr16:
78392024-78392024
TGintronicDe novo--Yuen2017 G
WWOX     2-0018-004chr16:
78970191-78970191
GTintronicDe novo--Yuen2017 G
WWOX     13023.p1chr16:
78382239-78382239
AGintronicDe novo--Turner2016 G
WWOX     1-0493-003chr16:
79130065-79130065
ACintronicDe novo--Yuen2017 G
WWOX     12175.p1chr16:
79541121-79541121
TCintergenicDe novo--Turner2016 G
WWOX     5-0015-003chr16:
79301278-79301278
CAintergenicDe novo--Yuen2017 G
WWOX     2-1370-003chr16:
78969308-78969308
AGintronicDe novo--Yuen2016 G
Yuen2017 G
WWOX     2-1702-003chr16:
79603603-79603609
GATGCCTGintergenicDe novo--Yuen2017 G
WWOX     1-0408-003chr16:
79211113-79211113
TCintronicDe novo--Yuen2016 G
Yuen2017 G
WWOX     2-1391-004chr16:
78748556-78748556
AGintronicDe novo--Yuen2017 G
WWOX     AU4283301chr16:
79465033-79465033
TCintergenicDe novo--Yuen2017 G
WWOX     2-1370-003chr16:
79336110-79336110
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
WWOX     AU1995302chr16:
78327562-78327562
TGintronicDe novo--Yuen2017 G
WWOX     AU1698302chr16:
78619162-78619162
CGintronicDe novo--Yuen2017 G
WWOX     2-0007-003chr16:
79563307-79563307
GAintergenicDe novo--Yuen2017 G
WWOX     AU1698302chr16:
78630207-78630207
CTintronicDe novo--Yuen2017 G
WWOX     AU1698302chr16:
78639812-78639812
AGintronicDe novo--Yuen2017 G
WWOX     2-0142-004chr16:
79363292-79363292
CTintergenicDe novo--Yuen2017 G
WWOX     7-0129-003chr16:
79433516-79433516
GAintergenicDe novo--Yuen2017 G
WWOX     1-0971-003chr16:
79224793-79224793
AGintronicDe novo--Yuen2017 G
WWOX     AU4033303chr16:
78635266-78635266
GTintronicDe novo--Yuen2017 G
WWOX     AU4496301chr16:
79334962-79334962
CAintergenicDe novo--Yuen2017 G
WWOX     PN400285chr16:
79245892-79245897
GGGGCTGUTR3Unknown-0.0075Leblond2019 E
WWOX     1-0304-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
WWOX     AU063005chr16:
78355622-78355626
GAGAAGAGAAGAAintronicDe novo--Yuen2017 G
WWOX     2-1737-003chr16:
78133388-78133388
CTUTR5De novo--Yuen2017 G
WWOX     PN400499chr16:
78149000-78149000
CTexonicUnknownnonsynonymous SNVNM_001291997
NM_016373
NM_130791
c.C19T
c.C358T
c.C358T
p.R7W
p.R120W
p.R120W
22.60.0076Leblond2019 E
WWOX     AU057405chr16:
78939816-78939819
TCCCTCCCCintronicDe novo--Yuen2017 G
WWOX     2-1322-004chr16:
78920941-78920941
GGAintronicDe novo--Yuen2017 G
WWOX     2-1142-003chr16:
79228244-79228244
AGintronicDe novo--Yuen2017 G
WWOX     2-1142-003chr16:
79223406-79223406
CGintronicDe novo--Yuen2017 G
WWOX     AU3680302chr16:
79466768-79466768
TCintergenicDe novo--Yuen2017 G
WWOX     2-1142-003chr16:
79220722-79220722
CGintronicDe novo--Yuen2017 G
WWOX     2-1441-003chr16:
79531531-79531531
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
WWOX     1-0751-003chr16:
79025598-79025598
CTintronicDe novo--Yuen2017 G
WWOX     2-1339-003chr16:
78674698-78674698
TCintronicDe novo--Yuen2017 G
WWOX     2-1511-003chr16:
79133470-79133486
CGTGTGTGTGTGTGTGTCGTGTGTGTGTGTGTintronicDe novo--Yuen2017 G
WWOX     AU1687302chr16:
79421139-79421139
AGintergenicDe novo--Yuen2017 G
WWOX     AU1687302chr16:
79592455-79592455
TAintergenicDe novo--Yuen2017 G
WWOX     AU2108302chr16:
79608690-79608690
GAintergenicDe novo--Yuen2017 G
WWOX     2-1425-004chr16:
78537015-78537015
CTintronicDe novo--Yuen2017 G
WWOX     1-0671-003chr16:
78833636-78833636
AGintronicDe novo--Yuen2017 G
WWOX     AU034904chr16:
78272394-78272394
CTintronicDe novo--Yuen2017 G
WWOX     AU034904chr16:
78598850-78598850
AGintronicDe novo--Yuen2017 G
WWOX     2-1364-003chr16:
78875693-78875693
TCintronicDe novo--Yuen2017 G
WWOX     AU076508chr16:
78675432-78675432
AGintronicDe novo--Yuen2017 G
WWOX     2-1117-003chr16:
78936921-78936921
GAintronicDe novo--Yuen2016 G
Yuen2017 G
WWOX     1-0265-004chr16:
78709601-78709601
GTintronicDe novo--Yuen2017 G
WWOX     1-0671-003chr16:
78871748-78871748
ATintronicDe novo--Yuen2017 G
WWOX     AU060004chr16:
79069159-79069159
CGintronicDe novo--Yuen2017 G
WWOX     AU3858303chr16:
78813531-78813531
GCintronicDe novo--Yuen2017 G
WWOX     12228.p1chr16:
79245677-79245677
GCexonicDe novononsynonymous SNVNM_001291997
NM_016373
c.G890C
c.G1229C
p.G297A
p.G410A
16.092.0E-4Ji2016 E
Krumm2015 E
WWOX     AU4473301chr16:
79256944-79256944
GAintergenicDe novo--Yuen2017 G
WWOX     2-1509-003chr16:
78983182-78983182
CTintronicDe novo--Yuen2017 G
WWOX     AU049304chr16:
78674548-78674548
AGintronicDe novo--Yuen2017 G
WWOX     5-0050-004chr16:
78272124-78272124
AGintronicDe novo--Yuen2017 G
WWOX     1-0400-003chr16:
79482827-79482827
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
WWOX     1-0325-003chr16:
78489842-78489842
GCintronicDe novo--Yuen2017 G
WWOX     1-0075-003chr16:
79595533-79595533
GAintergenicDe novo--Yuen2017 G
WWOX     AU2495302chr16:
78625435-78625435
ATintronicDe novo--Yuen2017 G
WWOX     AU3808305chr16:
78630549-78630549
ATintronicDe novo--Yuen2017 G
WWOX     PN400111chr16:
78149000-78149000
CTexonicUnknownnonsynonymous SNVNM_001291997
NM_016373
NM_130791
c.C19T
c.C358T
c.C358T
p.R7W
p.R120W
p.R120W
22.60.0076Leblond2019 E
WWOX     iHART2577chr16:
78458953-78458953
GCsplicingPaternalsplicing17.17-Ruzzo2019 G
WWOX     iHART2614chr16:
78143716-78143716
CTexonicPaternalstopgainNM_016373
NM_130791
c.C214T
c.C214T
p.Q72X
p.Q72X
37.04.14E-5Ruzzo2019 G
WWOX     PN400514chr16:
78149000-78149000
CTexonicUnknownnonsynonymous SNVNM_001291997
NM_016373
NM_130791
c.C19T
c.C358T
c.C358T
p.R7W
p.R120W
p.R120W
22.60.0076Leblond2019 E
WWOX     2-1475-003chr16:
79136852-79136852
CGintronicDe novo--Yuen2017 G
WWOX     PN400121chr16:
78149000-78149000
CTexonicUnknownnonsynonymous SNVNM_001291997
NM_016373
NM_130791
c.C19T
c.C358T
c.C358T
p.R7W
p.R120W
p.R120W
22.60.0076Leblond2019 E
WWOX     1-0636-003chr16:
78973170-78973170
CGintronicDe novo--Yuen2017 G
WWOX     7-0059-003chr16:
78692726-78692726
TCintronicDe novo--Yuen2017 G
WWOX     7-0082-003chr16:
78137988-78137988
GAintronicDe novo--Yuen2017 G
WWOX     1-0405-003chr16:
78300022-78300022
GTintronicDe novo--Yuen2017 G
WWOX     1-0994-003chr16:
78800671-78800671
CGintronicDe novo--Yuen2017 G
WWOX     7-0097-003chr16:
79182116-79182116
TAintronicDe novo--Yuen2017 G
WWOX     1-0744-003chr16:
79040943-79040943
CAintronicDe novo--Yuen2017 G
WWOX     AU2975301chr16:
78819759-78819759
TCintronicDe novo--Yuen2017 G
WWOX     2-1276-003chr16:
78800349-78800349
GCintronicDe novo--Yuen2016 G
Yuen2017 G
WWOX     AU2089302chr16:
78520853-78520853
TCintronicDe novo--Yuen2017 G
WWOX     AU0039303chr16:
79239744-79239744
GAintronicDe novo--Yuen2017 G
WWOX     1-0674-004chr16:
78570818-78570818
TCintronicDe novo--Yuen2017 G
WWOX     2-0278-003chr16:
78496517-78496517
GAintronicDe novo--Yuen2017 G
WWOX     2-1292-003chr16:
78521018-78521018
TCintronicDe novo--Yuen2017 G
WWOX     2-0278-003chr16:
78492114-78492114
CGintronicDe novo--Yuen2017 G
WWOX     2-1397-003chr16:
79015680-79015680
GTintronicDe novo--Yuen2017 G
WWOX     7-0130-003chr16:
79291234-79291234
CTintergenicDe novo--Yuen2017 G
WWOX     A11chr16:
78346972-78346972
ATintronicDe novo--Wu2018 G
WWOX     2-0013-003chr16:
78272555-78272555
TCintronicDe novo--Yuen2017 G
WWOX     74-0355chr16:
79149665-79149665
ACintronicDe novo--Michaelson2012 G
WWOX     74-0352chr16:
79622780-79622780
CTintergenicDe novo--Michaelson2012 G
WWOX     80001101216chr16:
79245803-79245803
TGUTR3De novo15.13-Satterstrom2020 E
WWOX     AU1687303chr16:
79421139-79421139
AGintergenicDe novo--Yuen2017 G
WWOX     2-0214-003chr16:
78463728-78463728
GAintronicDe novo--Yuen2017 G
WWOX     1-0024-003chr16:
78446095-78446095
GCintronicDe novo--Yuen2016 G
Yuen2017 G
WWOX     5-0065-003chr16:
79023168-79023168
AGintronicDe novo--Yuen2017 G
WWOX     2-1382-003chr16:
79182024-79182024
CAintronicDe novo--Yuen2016 G
Yuen2017 G
WWOX     1-0045-004chr16:
78939641-78939641
ATintronicDe novo--Yuen2017 G
WWOX     AU1687303chr16:
79592455-79592455
TAintergenicDe novo--Yuen2017 G
WWOX     1-0045-004chr16:
78904070-78904070
CAintronicDe novo--Yuen2017 G
WWOX     AU3794302chr16:
79038789-79038789
GCintronicDe novo--Yuen2017 G
WWOX     2-1283-003chr16:
79041460-79041460
AGintronicDe novo--Yuen2017 G
WWOX     2-1605-003chr16:
78875246-78875246
ACintronicDe novo--Yuen2017 G
WWOX     PN400114chr16:
78149000-78149000
CTexonicUnknownnonsynonymous SNVNM_001291997
NM_016373
NM_130791
c.C19T
c.C358T
c.C358T
p.R7W
p.R120W
p.R120W
22.60.0076Leblond2019 E
WWOX     AU4092302chr16:
78270739-78270739
CAintronicDe novo--Yuen2017 G
WWOX     PN400517chr16:
78149000-78149000
CTexonicUnknownnonsynonymous SNVNM_001291997
NM_016373
NM_130791
c.C19T
c.C358T
c.C358T
p.R7W
p.R120W
p.R120W
22.60.0076Leblond2019 E
WWOX     1-0863-003chr16:
78947746-78947746
CTintronicDe novo--Yuen2017 G
WWOX     1-0161-003chr16:
78315011-78315011
CTintronicDe novo--Yuen2017 G
WWOX     1-0898-003chr16:
79018557-79018557
CGintronicDe novo--Yuen2017 G
WWOX     1-0668-003chr16:
78355112-78355112
CAintronicDe novo--Yuen2017 G
WWOX     AU043804chr16:
78825705-78825707
AGGAGGGintronicDe novo--Yuen2017 G
WWOX     09C82560chr16:
79245541-79245541
GAexonicDe novononsynonymous SNVNM_001291997
NM_016373
c.G754A
c.G1093A
p.V252I
p.V365I
15.72-DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
WWOX     7-0254-004chr16:
79174723-79174723
CTintronicDe novo--Yuen2017 G
WWOX     1-0304-003chr16:
79342508-79342508
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
WWOX     1-0668-003chr16:
78357667-78357667
TGintronicDe novo--Yuen2017 G
WWOX     AU2525302chr16:
78936891-78936891
CTintronicDe novo--Yuen2017 G
WWOX     1-0395-003chr16:
79109219-79109219
GAintronicDe novo--Yuen2017 G
WWOX     1-0675-003chr16:
78805441-78805441
GTintronicDe novo--Yuen2017 G
WWOX     2-1429-004chr16:
79335967-79335967
ATintergenicDe novo--Yuen2017 G
WWOX     1-0265-003chr16:
78709601-78709601
GTintronicDe novo--Yuen2017 G
WWOX     2-1502-003chr16:
78757511-78757516
TTTCTTTTTintronicDe novo--Yuen2017 G
WWOX     2-1525-003chr16:
78874534-78874534
CTintronicDe novo--Yuen2017 G
WWOX     AU4429301chr16:
78988446-78988446
TCintronicDe novo--Yuen2017 G
WWOX     AU2123302chr16:
78153731-78153731
CGintronicDe novo--Yuen2017 G
WWOX     AU4429301chr16:
78989035-78989035
GAintronicDe novo--Yuen2017 G
WWOX     1-0173-004chr16:
78692726-78692726
TCintronicDe novo--Yuen2017 G
WWOX     2-1408-004chr16:
79281639-79281639
TCintergenicDe novo--Yuen2017 G
WWOX     AU3862305chr16:
78802311-78802311
AGintronicDe novo--Yuen2017 G
WWOX     1-0745-003chr16:
79465060-79465060
CTintergenicDe novo--Yuen2017 G
WWOX     AU4273304chr16:
78502889-78502889
CGintronicDe novo--Yuen2017 G
WWOX     AU059903chr16:
79612575-79612575
GAintergenicDe novo--Yuen2017 G
WWOX     PN400297chr16:
79245892-79245897
GGGGCTGUTR3Unknown-0.0075Leblond2019 E
WWOX     1-0150-003chr16:
78792011-78792011
AAATintronicDe novo--Yuen2017 G
WWOX     1-0300-003chr16:
78969855-78969855
CCAintronicDe novo--Yuen2017 G
WWOX     PN400484chr16:
78149000-78149000
CTexonicUnknownnonsynonymous SNVNM_001291997
NM_016373
NM_130791
c.C19T
c.C358T
c.C358T
p.R7W
p.R120W
p.R120W
22.60.0076Leblond2019 E
WWOX     AU4273304chr16:
78495380-78495380
GTintronicDe novo--Yuen2017 G
WWOX     2-0028-003chr16:
78967495-78967495
CTintronicDe novo--Yuen2016 G
Yuen2017 G
WWOX     AU4183301chr16:
78876707-78876707
CGintronicDe novo--Yuen2017 G
WWOX     AU3646301chr16:
78525942-78525942
GCintronicDe novo--Yuen2017 G
WWOX     PN400116chr16:
78149000-78149000
CTexonicUnknownnonsynonymous SNVNM_001291997
NM_016373
NM_130791
c.C19T
c.C358T
c.C358T
p.R7W
p.R120W
p.R120W
22.60.0076Leblond2019 E
WWOX     2-1359-004chr16:
79619185-79619185
CGintergenicDe novo--Yuen2017 G
WWOX     AU4089301chr16:
79292935-79292943
TCTCCTCCTTCTCCTintergenicDe novo--Yuen2017 G
WWOX     PN400257chr16:
78149000-78149000
CTexonicUnknownnonsynonymous SNVNM_001291997
NM_016373
NM_130791
c.C19T
c.C358T
c.C358T
p.R7W
p.R120W
p.R120W
22.60.0076Leblond2019 E
WWOX     PN400495chr16:
78149000-78149000
CTexonicUnknownnonsynonymous SNVNM_001291997
NM_016373
NM_130791
c.C19T
c.C358T
c.C358T
p.R7W
p.R120W
p.R120W
22.60.0076Leblond2019 E
WWOX     AU4153301chr16:
78762626-78762626
AGintronicDe novo--Yuen2017 G
WWOX     AU4153301chr16:
78771629-78771629
CGintronicDe novo--Yuen2017 G
WWOX     7-0251-003chr16:
78909614-78909614
CTintronicDe novo--Yuen2017 G
WWOX     2-1269-003chr16:
79426432-79426432
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
WWOX     PN400431chr16:
78149000-78149000
CTexonicUnknownnonsynonymous SNVNM_001291997
NM_016373
NM_130791
c.C19T
c.C358T
c.C358T
p.R7W
p.R120W
p.R120W
22.60.0076Leblond2019 E
WWOX     2-1283-004chr16:
79041460-79041460
AGintronicDe novo--Yuen2017 G
WWOX     AU4463303chr16:
78628827-78628827
GCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More