or
or
Exact

Results for "OPCML"

Variant Events: 85

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
OPCML     2-1215-003chr11:
132311063-132311063
TTTTTTTTTTGintronicDe novo--Yuen2017 G
OPCML     1-0359-003chr11:
133424680-133424680
CAintergenicDe novo--Yuen2017 G
OPCML     AU4092302chr11:
132877242-132877242
CAintronicDe novo--Yuen2017 G
OPCML     AU3900301chr11:
133157027-133157034
ATTTTTTTATTTTTTTTintronicDe novo--Yuen2017 G
OPCML     1-0604-003chr11:
132707156-132707156
CTintronicDe novo--Yuen2017 G
OPCML     5-0055-004chr11:
133121283-133121283
TCintronicDe novo--Yuen2017 G
OPCML     1-0009-004chr11:
132924985-132924985
GAintronicDe novo--Yuen2017 G
OPCML     2-1360-003chr11:
133080281-133080281
GAintronicDe novo--Yuen2017 G
OPCML     7-0068-003chr11:
132504991-132504991
AGintronicDe novo--Yuen2017 G
OPCML     AU4056302chr11:
132897483-132897483
GCintronicDe novo--Yuen2017 G
OPCML     AU066818chr11:
132526565-132526565
GAintronicDe novo--Yuen2017 G
OPCML     1-0567-004chr11:
132569959-132569959
TCintronicDe novo--Yuen2017 G
OPCML     3-0456-000chr11:
133380781-133380817
TACACACACACACACACGCACACACACACACACACACTACACACACACACACGCACACACACACACACACACintronicDe novo--Yuen2017 G
OPCML     AU4032305chr11:
133284030-133284030
GTintronicDe novo--Yuen2017 G
OPCML     1-0514-003chr11:
132632612-132632612
AGintronicDe novo--Yuen2016 G
Yuen2017 G
OPCML     1-0443-003chr11:
133244670-133244670
CAintronicDe novo--Yuen2016 G
OPCML     AU4433301chr11:
132685765-132685765
CAintronicDe novo--Yuen2017 G
OPCML     1-0138-004chr11:
133002057-133002057
CTintronicDe novo--Yuen2017 G
OPCML     AU070703chr11:
132347342-132347342
CTintronicDe novo--Yuen2017 G
OPCML     AU3859301chr11:
132312980-132312980
GAintronicDe novo--Yuen2017 G
OPCML     AU028305chr11:
133322183-133322190
AAAATCTAAAintronicDe novo--Yuen2017 G
OPCML     AU4379301chr11:
132635800-132635800
CTintronicDe novo--Yuen2017 G
OPCML     1-0006-004chr11:
133185145-133185145
CCTTintronicDe novo--Yuen2017 G
OPCML     1-0007-003chr11:
133450534-133450534
GCintergenicDe novo--Yuen2017 G
OPCML     AU2139301chr11:
132303557-132303557
GCintronicDe novo--Yuen2017 G
OPCML     74-0352chr11:
133255039-133255039
CTintronicDe novo--Michaelson2012 G
OPCML     AU4376301chr11:
133249460-133249460
CGintronicDe novo--Yuen2017 G
OPCML     2-0088-003chr11:
132897517-132897517
TTGTGATGCintronicDe novo--Yuen2017 G
OPCML     2-1425-004chr11:
132384406-132384406
GGCintronicDe novo--Yuen2017 G
OPCML     AU005214chr11:
132306284-132306284
AGintronicDe novo--Yuen2017 G
OPCML     2-0122-004chr11:
133009176-133009176
GAintronicDe novo--Yuen2017 G
OPCML     1-0169-003chr11:
132897517-132897517
TTGTGATGCintronicDe novo--Yuen2017 G
OPCML     A3chr11:
132446810-132446810
CTintronicDe novo--Wu2018 G
OPCML     2-1374-003chr11:
133286812-133286812
CTintronicDe novo--Yuen2017 G
OPCML     1-0901-004chr11:
133260227-133260227
GAintronicDe novo--Yuen2017 G
OPCML     1-0566-003chr11:
132592571-132592571
TCintronicDe novo--Yuen2017 G
OPCML     AU3905301chr11:
133087487-133087487
GAintronicDe novo--Yuen2017 G
OPCML     1-0357-003chr11:
133236383-133236383
AGintronicDe novo--Yuen2017 G
OPCML     7-0058-003chr11:
132677105-132677105
GAintronicDe novo--Yuen2017 G
OPCML     AU2023302chr11:
133539679-133539679
CTintergenicDe novo--Yuen2017 G
OPCML     AU3637301chr11:
132776047-132776047
CTintronicDe novo--Yuen2017 G
OPCML     AU3903302chr11:
133441362-133441362
TCintergenicDe novo--Yuen2017 G
OPCML     AU3811305chr11:
132385007-132385007
CTintronicDe novo--Yuen2017 G
OPCML     2-1444-003chr11:
132927464-132927464
ATintronicDe novo--Yuen2016 G
Yuen2017 G
OPCML     AU050604chr11:
133334764-133334764
ATintronicDe novo--Yuen2017 G
OPCML     1-0162-004chr11:
132449600-132449600
CTintronicDe novo--Yuen2017 G
OPCML     AU3777301chr11:
132354820-132354820
GAintronicDe novo--Yuen2017 G
OPCML     2-1291-003chr11:
133002649-133002649
CTintronicDe novo--Yuen2016 G
Yuen2017 G
OPCML     AU026604chr11:
132522947-132522947
CTintronicDe novo--Yuen2017 G
OPCML     AU031204chr11:
133381961-133381963
ACCACCCintronicDe novo--Yuen2017 G
OPCML     1-0271-003chr11:
132392557-132392557
GAintronicDe novo--Yuen2017 G
OPCML     1-0433-004chr11:
133174445-133174445
GAintronicDe novo--Yuen2017 G
OPCML     7-0141-003chr11:
132633129-132633129
CTintronicDe novo--Yuen2017 G
OPCML     1-0332-003chr11:
133189415-133189415
AATCintronicDe novo--Yuen2017 G
OPCML     2-1696-003chr11:
133174729-133174729
TCintronicDe novo--Yuen2017 G
OPCML     2-1402-003chr11:
133607876-133607876
CAintergenicDe novo--Yuen2017 G
OPCML     AU076808chr11:
133538592-133538592
TCintergenicDe novo--Yuen2017 G
OPCML     14545.p1chr11:
133318969-133318969
TCintronicDe novo--Werling2018 G
OPCML     AU3729303chr11:
132550660-132550660
TCintronicDe novo--Yuen2017 G
OPCML     AU3727303chr11:
133529609-133529609
GTintergenicDe novo--Yuen2017 G
OPCML     2-0019-004chr11:
132697947-132697947
AAAGintronicDe novo--Yuen2017 G
OPCML     1-0636-003chr11:
132440428-132440428
GTintronicDe novo--Yuen2017 G
OPCML     AU1668302chr11:
133537753-133537766
GGAGTCCACCTTCGGGintergenicDe novo--Yuen2017 G
OPCML     AU2293301chr11:
133509236-133509236
CTintergenicDe novo--Yuen2017 G
OPCML     5-0105-003chr11:
133293647-133293647
GCintronicDe novo--Yuen2017 G
OPCML     13692.p1chr11:
133246735-133246737
CTTCintronicDe novo--Werling2018 G
OPCML     1-0067-004chr11:
133132122-133132122
CTintronicDe novo--Yuen2017 G
OPCML     2-0503-004chr11:
133203377-133203377
CTintronicDe novo--Yuen2017 G
OPCML     AU009904chr11:
132504763-132504763
ACintronicDe novo--Yuen2017 G
OPCML     2-0149-004chr11:
132897515-132897515
GGTGTGTTGTintronicDe novo--Yuen2017 G
OPCML     2-0122-003chr11:
132897651-132897651
GGGGAATGTAGTintronicDe novo--Yuen2017 G
OPCML     2-1456-003chr11:
133520060-133520060
GAintergenicDe novo--Yuen2017 G
OPCML     2-1105-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
OPCML     1-0025-004chr11:
132486776-132486776
GAintronicDe novo--Yuen2017 G
OPCML     1-0632-003chr11:
132303327-132303327
CTintronicDe novo--Yuen2017 G
OPCML     AU054303chr11:
132931856-132931856
ACintronicDe novo--Yuen2017 G
OPCML     1-0380-003chr11:
132586368-132586368
TCintronicDe novo--Yuen2017 G
OPCML     1-0935-003chr11:
133059174-133059174
GCintronicDe novo--Yuen2017 G
OPCML     AU3760301chr11:
133506773-133506773
GAintergenicDe novo--Yuen2017 G
OPCML     5-0129-003chr11:
133526201-133526201
GAintergenicDe novo--Yuen2017 G
OPCML     AU4394302chr11:
132554574-132554574
ATintronicDe novo--Yuen2017 G
OPCML     1-0201-005chr11:
132448274-132448274
GGCTAintronicDe novo--Yuen2017 G
OPCML     1-0292-005chr11:
132897385-132897385
TTCintronicDe novo--Yuen2017 G
OPCML     2-1297-004chr11:
133587592-133587592
GAintergenicDe novo--Yuen2017 G
OPCML     2-0503-003chr11:
133203377-133203377
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More