or
or
Exact

Results for "NFATC1"

Variant Events: 30

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NFATC1     AU4199303chr18:
77302219-77302219
CCCATintergenicDe novo--Yuen2017 G
NFATC1     12961.p1chr18:
77160481-77160481
TGsplicingDe novosplicing12.47-Ji2016 E
Krumm2015 E
Lim2017 E
Satterstrom2020 E
Wilfert2021 G
NFATC1     2-1579-003chr18:
77200666-77200666
GAintronicDe novo--Yuen2017 G
NFATC1     2-1591-003chr18:
77169633-77169633
CGintronicDe novo--Yuen2017 G
NFATC1     2-1195-003chr18:
77253663-77253663
TCintronicDe novo--Yuen2016 G
NFATC1     1-0435-003chr18:
77203704-77203704
CTintronicDe novo--Yuen2017 G
NFATC1     1-0065-005chr18:
77437846-77437846
GAintergenicDe novo--Yuen2017 G
NFATC1     2-1629-003chr18:
77266645-77266650
ATTTTTATTTTTTintronicDe novo--Yuen2017 G
NFATC1     2-0296-003chr18:
77180937-77180937
CGintronicDe novo--Yuen2017 G
NFATC1     1-0511-003chr18:
77174779-77174779
TCintronicDe novo--Yuen2017 G
NFATC1     2-0090-003chr18:
77313590-77313590
GAintergenicDe novo--Yuen2017 G
NFATC1     09C89982chr18:
77170989-77170989
CTexonicDe novosynonymous SNVNM_001278669
NM_001278670
NM_001278672
NM_001278675
NM_006162
NM_172387
NM_172389
NM_172390
c.C714T
c.C714T
c.C675T
c.C675T
c.C714T
c.C675T
c.C675T
c.C714T
p.P238P
p.P238P
p.P225P
p.P225P
p.P238P
p.P225P
p.P225P
p.P238P
--Satterstrom2020 E
NFATC1     2-1207-003chr18:
77236054-77236054
GTintronicDe novo--Yuen2016 G
NFATC1     1-0169-003chr18:
77223481-77223481
CCGTTCCCGTGTCCACACCGGCCTCTCCTCCCCGCAGCATintronicDe novo--Yuen2017 G
NFATC1     2-1114-003chr18:
77404311-77404311
GAintergenicDe novo--Yuen2017 G
NFATC1     AU2793302chr18:
77198025-77198025
CTintronicDe novo--Yuen2017 G
NFATC1     72-1047chr18:
77208917-77208917
GAexonicInheritednonsynonymous SNVNM_001278673
NM_172388
NM_001278669
NM_001278670
NM_001278672
NM_001278675
NM_006162
NM_172387
NM_172389
NM_172390
c.G106A
c.G106A
c.G1522A
c.G1522A
c.G1483A
c.G1483A
c.G1522A
c.G1483A
c.G1483A
c.G1522A
p.E36K
p.E36K
p.E508K
p.E508K
p.E495K
p.E495K
p.E508K
p.E495K
p.E495K
p.E508K
31.0-Patowary2019 E
NFATC1     A32chr18:
77230727-77230727
TCintronicDe novo--Wu2018 G
NFATC1     1-0080-003chr18:
77372637-77372637
GCintergenicDe novo--Yuen2017 G
NFATC1     AU2029301chr18:
77394078-77394083
GTGATGGTGintergenicDe novo--Yuen2017 G
NFATC1     1-0496-003chr18:
77318720-77318720
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
NFATC1     2-0242-004chr18:
77221320-77221320
AGexonicDe novononsynonymous SNVNM_001278673
NM_172388
NM_001278669
NM_001278670
NM_001278672
NM_001278675
NM_006162
NM_172387
NM_172389
NM_172390
c.A497G
c.A497G
c.A1913G
c.A1913G
c.A1874G
c.A1874G
c.A1913G
c.A1874G
c.A1874G
c.A1913G
p.H166R
p.H166R
p.H638R
p.H638R
p.H625R
p.H625R
p.H638R
p.H625R
p.H625R
p.H638R
10.418.268E-6Yuen2017 G
NFATC1     AU3122301chr18:
77170989-77170989
CTexonicDe novosynonymous SNVNM_001278669
NM_001278670
NM_001278672
NM_001278675
NM_006162
NM_172387
NM_172389
NM_172390
c.C714T
c.C714T
c.C675T
c.C675T
c.C714T
c.C675T
c.C675T
c.C714T
p.P238P
p.P238P
p.P225P
p.P225P
p.P238P
p.P225P
p.P225P
p.P238P
--Yuen2017 G
NFATC1     AU3729303chr18:
77251111-77251111
GTintronicDe novo--Yuen2017 G
NFATC1     1-0383-003chr18:
77324122-77324122
TGintergenicDe novo--Yuen2017 G
NFATC1     1-0627-006chr18:
77223487-77223487
CTintronicDe novo--Yuen2017 G
NFATC1     5-0140-003chr18:
77315721-77315721
CTintergenicDe novo--Yuen2017 G
NFATC1     13069.p1chr18:
77378345-77378345
CTintergenicDe novo--Turner2016 G
NFATC1     AU4237301chr18:
77308242-77308242
GAintergenicDe novo--Yuen2017 G
NFATC1     63-343chr18:
77191334-77191334
GAintronicDe novo--Michaelson2012 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More