or
or
Exact

Results for "SNX19"

Variant Events: 29

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SNX19     1-0219-003chr11:
130970489-130970489
TCintergenicDe novo--Yuen2017 G
SNX19     1-0193-003chr11:
130992148-130992148
CGintergenicDe novo--Yuen2017 G
SNX19     AU065304chr11:
130769651-130769665
TAGTTACAACAAGTTTAGTTintronicDe novo--Yuen2017 G
SNX19     2-0242-003chr11:
131231313-131231313
TCintergenicDe novo--Yuen2017 G
SNX19     2-1441-003chr11:
130817922-130817940
TGAGAGAGAGAGAGAGAGATGAGAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
SNX19     AU2433302chr11:
130770603-130770603
CTintronicDe novo--Yuen2017 G
SNX19     AU1952305chr11:
131122775-131122775
ATintergenicDe novo--Yuen2017 G
SNX19     AU4145301chr11:
130867219-130867219
TCintergenicDe novo--Yuen2017 G
SNX19     13884.p1chr11:
130775881-130775881
CTexonicDe novononsynonymous SNVNM_001301089
NM_014758
c.G550A
c.G2410A
p.V184M
p.V804M
11.591.0E-4Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
SNX19     1-0436-003chr11:
130817922-130817940
TGAGAGAGAGAGAGAGAGATGAGAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
SNX19     AU2137304chr11:
131202552-131202552
CTintergenicDe novo--Yuen2017 G
SNX19     AU007503chr11:
130753887-130753887
GAintronicDe novo--Yuen2017 G
SNX19     1-0651-003chr11:
131056229-131056229
CGintergenicDe novo--Yuen2017 G
SNX19     Lim2017:35985chr11:
130775881-130775881
CTexonicDe novononsynonymous SNVNM_001301089
NM_014758
c.G550A
c.G2410A
p.V184M
p.V804M
11.591.0E-4Lim2017 E
SNX19     AU4015303chr11:
130954988-130954988
GCintergenicDe novo--Yuen2017 G
SNX19     74-0075chr11:
130753887-130753887
GAintronicDe novo--Michaelson2012 G
SNX19     2-1437-003chr11:
130971059-130971059
CGintergenicDe novo--Yuen2017 G
SNX19     AU3076302chr11:
130854874-130854874
GAintergenicDe novo--Yuen2017 G
SNX19     5-0055-003chr11:
130968175-130968175
TCintergenicDe novo--Yuen2017 G
SNX19     2-1093-005chr11:
130837570-130837571
ACAintergenicDe novo--Yuen2017 G
SNX19     2-1337-003chr11:
130819719-130819719
ATintergenicDe novo--Yuen2016 G
Yuen2017 G
SNX19     1-0498-003chr11:
131034607-131034625
CATTATTATTATTATTATTCATTATTATTATTATTintergenicDe novo--Yuen2017 G
SNX19     AU3858302chr11:
131023758-131023758
GAintergenicDe novo--Yuen2017 G
SNX19     2-1408-003chr11:
130862966-130862966
CTintergenicDe novo--Yuen2017 G
SNX19     3-0436-000chr11:
130968979-130968979
TGintergenicDe novo--Yuen2017 G
SNX19     2-1715-004chr11:
131231303-131231303
AGintergenicDe novo--Yuen2017 G
SNX19     AU049304chr11:
131052324-131052324
CTintergenicDe novo--Yuen2017 G
SNX19     AU4145303chr11:
130744763-130744768
GTGTTGGTGTTGTTGdownstreamDe novo--Yuen2017 G
SNX19     AU049304chr11:
131115842-131115842
AGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More