or
or
Exact

Results for "LINC01550"

Variant Events: 53

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LINC01550     AU3900302chr14:
98622669-98622669
CTintergenicDe novo--Yuen2017 G
LINC01550     1-0158-012chr14:
99145118-99145118
AACintergenicDe novo--Yuen2017 G
LINC01550     1-0345-003chr14:
98449987-98449987
CTintergenicDe novo--Yuen2017 G
LINC01550     1-0699-003chr14:
98538474-98538474
GTintergenicDe novo--Yuen2017 G
LINC01550     1-0496-003chr14:
98966707-98966708
ACAintergenicDe novo--Yuen2017 G
LINC01550     1-0186-004chr14:
98661655-98661656
GCGintergenicDe novo--Yuen2017 G
LINC01550     AU2072302chr14:
99077042-99077042
CTintergenicDe novo--Yuen2017 G
LINC01550     AU4007301chr14:
98859910-98859910
GAintergenicDe novo--Yuen2017 G
LINC01550     AU061104chr14:
98448782-98448782
GAintergenicDe novo--Yuen2017 G
LINC01550     AU3951301chr14:
98711333-98711333
AGintergenicDe novo--Yuen2017 G
LINC01550     AU3911301chr14:
98605661-98605661
CAintergenicDe novo--Yuen2017 G
LINC01550     AU3911301chr14:
98972436-98972436
CAintergenicDe novo--Yuen2017 G
LINC01550     5-0077-003chr14:
99145099-99145099
AATTCTAGTCTGintergenicDe novo--Yuen2017 G
LINC01550     AU031004chr14:
98664019-98664020
TATintergenicDe novo--Yuen2017 G
LINC01550     AU2129301chr14:
99139882-99139882
TCintergenicDe novo--Yuen2017 G
LINC01550     AU2793301chr14:
99159985-99159985
CAintergenicDe novo--Yuen2017 G
LINC01550     2-0116-005chr14:
98563492-98563494
AACAintergenicDe novo--Yuen2017 G
LINC01550     AU075703chr14:
98816415-98816415
AGintergenicDe novo--Yuen2017 G
LINC01550     2-0129-004chr14:
99145082-99145082
AATCintergenicDe novo--Yuen2017 G
LINC01550     7-0102-003chr14:
99085376-99085376
ACintergenicDe novo--Yuen2017 G
LINC01550     2-1093-005chr14:
98911356-98911356
CTintergenicDe novo--Yuen2017 G
LINC01550     7-0249-003chr14:
98799073-98799073
ACintergenicDe novo--Yuen2017 G
LINC01550     2-1323-003chr14:
98792921-98792921
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01550     AU2525302chr14:
98848797-98848797
CTintergenicDe novo--Yuen2017 G
LINC01550     AU2525302chr14:
99042482-99042482
CAintergenicDe novo--Yuen2017 G
LINC01550     1-0296-003chr14:
98657730-98657730
GAintergenicDe novo--Yuen2017 G
LINC01550     1-0150-004chr14:
98543396-98543396
TCintergenicDe novo--Yuen2017 G
LINC01550     AU3713302chr14:
99074722-99074722
CAintergenicDe novo--Yuen2017 G
LINC01550     5-0030-003chr14:
98611624-98611624
GAintergenicDe novo--Yuen2017 G
LINC01550     1-0144-004chr14:
98931479-98931479
CTintergenicDe novo--Yuen2017 G
LINC01550     2-0132-004chr14:
99145118-99145118
AACintergenicDe novo--Yuen2017 G
LINC01550     1-0862-003chr14:
98676087-98676087
CTintergenicDe novo--Yuen2017 G
LINC01550     AU3610302chr14:
99013669-99013669
CAintergenicDe novo--Yuen2017 G
LINC01550     2-0297-003chr14:
98425658-98425658
TCncRNA_intronicDe novo--Yuen2017 G
LINC01550     1-0162-004chr14:
98810766-98810766
GAintergenicDe novo--Yuen2017 G
LINC01550     1-0325-003chr14:
98999162-98999162
CTintergenicDe novo--Yuen2017 G
LINC01550     AU3712301chr14:
98755422-98755422
CGintergenicDe novo--Yuen2017 G
LINC01550     1-0347-003chr14:
98520623-98520623
GAintergenicDe novo--Yuen2017 G
LINC01550     1-0408-003chr14:
99042397-99042397
GCintergenicDe novo--Yuen2017 G
LINC01550     1-0433-004chr14:
99145102-99145102
CCATTCTAGTCTGGGCAACAAAGintergenicDe novo--Yuen2017 G
LINC01550     AU2140306chr14:
99088916-99088916
GCintergenicDe novo--Yuen2017 G
LINC01550     1-0479-006chr14:
98805754-98805754
CTintergenicDe novo--Yuen2017 G
LINC01550     1-0347-003chr14:
99145099-99145099
AATTCTAGTCTGintergenicDe novo--Yuen2017 G
LINC01550     1-0054-004chr14:
99023664-99023664
GAintergenicDe novo--Yuen2017 G
LINC01550     AU4067303chr14:
98747778-98747778
GTintergenicDe novo--Yuen2017 G
LINC01550     2-1322-003chr14:
99145102-99145102
CCATTCTAGTCTGGGCAACAAAGintergenicDe novo--Yuen2017 G
LINC01550     AU3368303chr14:
98914005-98914005
GAintergenicDe novo--Yuen2017 G
LINC01550     AU3399302chr14:
98652189-98652189
GAintergenicDe novo--Yuen2017 G
LINC01550     1-0269-005chr14:
98667184-98667184
GAintergenicDe novo--Yuen2017 G
LINC01550     7-0188-003chr14:
98746876-98746877
CTCintergenicDe novo--Yuen2017 G
LINC01550     74-0688chr14:
98449324-98449324
GAintergenicDe novo--Michaelson2012 G
LINC01550     AU050603chr14:
98986363-98986363
TGintergenicDe novo--Yuen2017 G
LINC01550     1-0483-003chr14:
98993831-98993831
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More