or
or
Exact

Results for "ITPR2"

Variant Events: 33

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ITPR2     1-0772-003chr12:
26716759-26716759
GCintronicDe novo--Yuen2017 G
ITPR2     2-1529-003chr12:
27015561-27015575
GCTCTCTCTCTCTCTGCTCTCTCTCTCTintergenicDe novo--Yuen2017 G
ITPR2     2-1167-003chr12:
26666789-26666789
TAintronicDe novo--Yuen2016 G
Yuen2017 G
ITPR2     2-1250-003chr12:
26541820-26541820
CTintronicDe novo--Yuen2017 G
ITPR2     1-0402-003chr12:
26958672-26958672
GGCintronicDe novo--Yuen2017 G
ITPR2     1-0336-003chr12:
26829666-26829666
CAintronicDe novo--Yuen2017 G
ITPR2     AU1725306chr12:
26815673-26815673
ACintronicDe novo--Yuen2017 G
ITPR2     2-1627-003chr12:
26543351-26543351
ATintronicDe novo--Yuen2017 G
ITPR2     2-1379-003chr12:
26632383-26632383
TCintronicDe novo--Yuen2016 G
Yuen2017 G
ITPR2     2-0219-004chr12:
26519455-26519455
CTintronicDe novo--Yuen2017 G
ITPR2     2-0307-003chr12:
26650425-26650425
TTGCCintronicDe novo--Yuen2017 G
ITPR2     1-0541-003chr12:
26851408-26851408
TGintronicDe novo--Yuen2017 G
ITPR2     2-0299-005chr12:
26650425-26650425
TTGCCintronicDe novo--Yuen2017 G
ITPR2     AU046708chr12:
27010461-27010461
TGintergenicDe novo--Yuen2017 G
ITPR2     2-0295-003chr12:
26790086-26790086
TCintronicDe novo--Yuen2017 G
ITPR2     12795.p1chr12:
26942112-26942112
AGintronicDe novo--Turner2016 G
Werling2018 G
ITPR2     2-0202-003chr12:
26776426-26776426
TCintronicDe novo--Yuen2017 G
ITPR2     2-1066-003chr12:
26650425-26650425
TTGCCintronicDe novo--Yuen2017 G
ITPR2     5-0003-004chr12:
26650425-26650425
TTGCCintronicDe novo--Yuen2017 G
ITPR2     1-0405-003chr12:
26540119-26540119
TCintronicDe novo--Yuen2017 G
ITPR2     1-0481-003chr12:
26650425-26650425
TTGCCintronicDe novo--Yuen2017 G
ITPR2     AU007503chr12:
27007722-27007722
CTintergenicDe novo--Yuen2017 G
ITPR2     2-0240-004chr12:
26650425-26650425
TTGCCintronicDe novo--Yuen2017 G
ITPR2     2-1406-003chr12:
26642284-26642284
GAintronicDe novo--Yuen2016 G
Yuen2017 G
ITPR2     74-0075chr12:
27007722-27007722
CTintergenicDe novo--Michaelson2012 G
ITPR2     1-0006-003chr12:
26532714-26532714
GGTAintronicDe novo--Yuen2017 G
ITPR2     AU3765303chr12:
26656372-26656372
AGintronicDe novo--Yuen2017 G
ITPR2     2-1376-003chr12:
26676281-26676281
CGintronicDe novo--Yuen2016 G
Yuen2017 G
ITPR2     AU071203chr12:
26887853-26887853
CTintronicDe novo--Yuen2017 G
ITPR2     2-1327-004chr12:
26487631-26487631
TGdownstreamDe novo--Yuen2017 G
ITPR2     2-1339-003chr12:
26650425-26650425
TTGCCintronicDe novo--Yuen2017 G
ITPR2     1-0158-012chr12:
26650425-26650425
TTGCCintronicDe novo--Yuen2017 G
ITPR2     2-0215-003chr12:
26650425-26650425
TTGCCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More