or
or
Exact

Results for "GABRG3"

Variant Events: 42

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GABRG3     2-1356-003chr15:
27239009-27239022
CTATATATATATATCTATATATATATintronicDe novo--Yuen2017 G
GABRG3     1-0272-004chr15:
27986849-27986849
GCintergenicDe novo--Yuen2017 G
GABRG3     AU2129303chr15:
27910281-27910281
GAintergenicDe novo--Yuen2017 G
GABRG3     AU3891302chr15:
27725575-27725575
ACintronicDe novo--Yuen2017 G
GABRG3     2-1374-003chr15:
27606445-27606445
AGintronicDe novo--Yuen2017 G
GABRG3     2-0303-004chr15:
27564737-27564737
CTintronicDe novo--Yuen2017 G
GABRG3     2-1114-003chr15:
27959263-27959263
CTintergenicDe novo--Yuen2017 G
GABRG3     AU3847302chr15:
27230027-27230027
TCintronicDe novo--Yuen2017 G
GABRG3     2-1146-003chr15:
27955569-27955569
TCintergenicDe novo--Yuen2017 G
GABRG3     3-0447-000chr15:
27390772-27390773
CTCintronicDe novo--Yuen2017 G
GABRG3     2-1276-003chr15:
27252248-27252248
ATintronicDe novo--Yuen2016 G
GABRG3     AU3900301chr15:
27460397-27460397
GAintronicDe novo--Yuen2017 G
GABRG3     AU3782303chr15:
27702629-27702629
CAintronicDe novo--Yuen2017 G
GABRG3     AU3790302chr15:
27962524-27962524
GAintergenicDe novo--Yuen2017 G
GABRG3     AU3786301chr15:
27553089-27553095
CATATATCATATintronicDe novo--Yuen2017 G
GABRG3     A9chr15:
27799311-27799311
CTintergenicDe novo--Wu2018 G
GABRG3     1-0991-003chr15:
27746097-27746098
TGTintronicDe novo--Yuen2017 G
GABRG3     1006001chr15:
27772749-27772749
CAexonicDe novononsynonymous SNVNM_033223c.C1036Ap.P346T15.62-Satterstrom2020 E
GABRG3     5-0077-004chr15:
27387397-27387397
GAintronicDe novo--Yuen2017 G
GABRG3     AU1952305chr15:
27919736-27919736
CTintergenicDe novo--Yuen2017 G
GABRG3     AU1640302chr15:
27480582-27480582
CGintronicDe novo--Yuen2017 G
GABRG3     2-0070-004chr15:
27450367-27450369
GATGintronicDe novo--Yuen2017 G
GABRG3     1-0497-003chr15:
27684831-27684831
CGintronicDe novo--Yuen2017 G
GABRG3     2-1402-003chr15:
27367154-27367154
CTintronicDe novo--Yuen2017 G
GABRG3     AU066404chr15:
27824579-27824579
TCintergenicDe novo--Yuen2017 G
GABRG3     AU3760302chr15:
27438346-27438346
GAintronicDe novo--Yuen2017 G
GABRG3     2-1213-003chr15:
27864653-27864653
CTintergenicDe novo--Yuen2017 G
GABRG3     1-0153-004chr15:
27766019-27766019
ATintronicDe novo--Yuen2017 G
GABRG3     74-0352chr15:
27388484-27388484
CTintronicDe novo--Michaelson2012 G
GABRG3     AU4028302chr15:
27342809-27342809
CTintronicDe novo--Yuen2017 G
GABRG3     AU017704chr15:
27829078-27829078
ATintergenicDe novo--Yuen2017 G
GABRG3     1-0440-003chr15:
27959835-27959835
TGintergenicDe novo--Yuen2017 G
GABRG3     A23chr15:
27443116-27443116
TCintronicDe novo--Wu2018 G
GABRG3     2-0033-003chr15:
27390772-27390773
CTCintronicDe novo--Yuen2017 G
GABRG3     AU2089302chr15:
27957529-27957529
CTintergenicDe novo--Yuen2017 G
GABRG3     AU2123301chr15:
27669901-27669901
TCintronicDe novo--Yuen2017 G
GABRG3     2-1166-003chr15:
27309133-27309133
GAintronicDe novo--Yuen2016 G
Yuen2017 G
GABRG3     AU2711303chr15:
27221771-27221771
TCintronicDe novo--Yuen2017 G
GABRG3     14637.p1chr15:
27729161-27729161
AGintronicDe novo--Turner2016 G
GABRG3     13515.p1chr15:
27710725-27710725
CTintronicDe novo--Turner2016 G
GABRG3     1-0835-003chr15:
27964457-27964472
GTCTCTCTCTCTCTCTGTCTCTCTCTCTCTintergenicDe novo--Yuen2017 G
GABRG3     AU024004chr15:
27933159-27933159
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More