or
or
Exact

Results for "PHLPP1"

Variant Events: 25

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PHLPP1     AU3874301chr18:
60544904-60544904
TCintronicDe novo--Yuen2017 G
PHLPP1     1-0559-004chr18:
60739800-60739800
GAintergenicDe novo--Yuen2017 G
PHLPP1     2-1342-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
PHLPP1     1-0393-003chr18:
60385380-60385380
GAintronicDe novo--Yuen2017 G
PHLPP1     11194.p1chr18:
60785750-60785750
AGintergenicDe novo--Turner2016 G
PHLPP1     AU073005chr18:
60603454-60603454
CTintronicDe novo--Yuen2017 G
PHLPP1     14015.p1chr18:
60383075-60383075
CGexonicDe novosynonymous SNVNM_194449c.C159Gp.P53P--Turner2016 G
PHLPP1     12529.p1chr18:
60584709-60584709
TGintronicDe novo--Turner2016 G
PHLPP1     1-0606-003chr18:
60652297-60652297
AGintergenicDe novo--Yuen2017 G
PHLPP1     7-0024-005chr18:
60695489-60695489
CAintergenicDe novo--Yuen2017 G
PHLPP1     1-0604-003chr18:
60597045-60597045
GAintronicDe novo--Yuen2017 G
PHLPP1     5-0128-003chr18:
60452463-60452469
GTAGATAGTAintronicDe novo--Yuen2017 G
PHLPP1     AU1355301chr18:
60508132-60508132
TCintronicDe novo--Yuen2017 G
PHLPP1     AU2165301chr18:
60409982-60409982
CTintronicDe novo--Yuen2017 G
PHLPP1     AU2000302chr18:
60546096-60546096
GAintronicDe novo--Yuen2017 G
PHLPP1     AU3724301chr18:
60726120-60726121
GAGintergenicDe novo--Yuen2017 G
PHLPP1     1-0636-003chr18:
60709457-60709457
AGintergenicDe novo--Yuen2017 G
PHLPP1     1-0564-003chr18:
60777846-60777861
CTGGTGGTGGTGGTGGCTGGTGGTGGTGGintergenicDe novo--Yuen2017 G
PHLPP1     AU1952305chr18:
60396884-60396884
GTintronicDe novo--Yuen2017 G
PHLPP1     AU2139303chr18:
60509725-60509725
GCintronicDe novo--Yuen2017 G
PHLPP1     7-0123-003chr18:
60492737-60492741
GCTCTGCTintronicDe novo--Yuen2017 G
PHLPP1     74-0075chr18:
60716621-60716621
TAintergenicDe novo--Michaelson2012 G
PHLPP1     1-0402-004chr18:
60741682-60741682
GAintergenicDe novo--Yuen2017 G
PHLPP1     1-0153-004chr18:
60403062-60403062
GCintronicDe novo--Yuen2017 G
PHLPP1     A30chr18:
60409467-60409467
TCintronicDe novo--Wu2018 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More