or
or
Exact

Results for "CLEC14A"

Variant Events: 24

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CLEC14A     SJD_10chr14:
38724806-38724806
CTexonicMaternalnonsynonymous SNVNM_175060c.G422Ap.R141Q16.825.299E-5Toma2013 E
CLEC14A     74-0075chr14:
39019415-39019415
GTintergenicDe novo--Michaelson2012 G
CLEC14A     5-0137-003chr14:
39194738-39194738
TCintergenicDe novo--Yuen2017 G
CLEC14A     1-0231-004chr14:
39162391-39162391
AGintergenicDe novo--Yuen2017 G
CLEC14A     1-0073-003chr14:
39151522-39151522
GAintergenicDe novo--Yuen2017 G
CLEC14A     2-1169-004chr14:
38880002-38880002
TCintergenicDe novo--Yuen2017 G
CLEC14A     AU3634301chr14:
39046018-39046018
CGintergenicDe novo--Yuen2017 G
CLEC14A     7-0002-003chr14:
39088590-39088590
TTCintergenicDe novo--Yuen2017 G
CLEC14A     AU0540301chr14:
39016030-39016030
CTintergenicDe novo--Yuen2017 G
CLEC14A     AU031003chr14:
39134172-39134172
ACintergenicDe novo--Yuen2017 G
CLEC14A     2-1626-003chr14:
39105819-39105819
GAintergenicDe novo--Yuen2017 G
CLEC14A     5-0088-003chr14:
38724800-38724800
CTexonicDe novononsynonymous SNVNM_175060c.G428Ap.C143Y20.5-Yuen2017 G
CLEC14A     AU062204chr14:
38952184-38952184
AGintergenicDe novo--Yuen2017 G
CLEC14A     7-0251-003chr14:
38957023-38957023
GAintergenicDe novo--Yuen2017 G
CLEC14A     2-1408-004chr14:
39051831-39051831
CTintergenicDe novo--Yuen2017 G
CLEC14A     2-1283-003chr14:
38797465-38797466
GAGintergenicDe novo--Yuen2017 G
CLEC14A     AU3885304chr14:
38931345-38931377
AGGTTTCTAATATAGGTACACATATGCCATGGTAGGTintergenicDe novo--Yuen2017 G
CLEC14A     AU3905301chr14:
39204988-39204988
TCintergenicDe novo--Yuen2017 G
CLEC14A     2-1283-004chr14:
38797465-38797466
GAGintergenicDe novo--Yuen2017 G
CLEC14A     2-1327-004chr14:
38931636-38931636
AATGGTGintergenicDe novo--Yuen2017 G
CLEC14A     1-0368-004chr14:
38804245-38804245
AGintergenicDe novo--Yuen2017 G
CLEC14A     AU2863302chr14:
38975996-38975996
TCintergenicDe novo--Yuen2017 G
CLEC14A     AU4067301chr14:
38845945-38845945
GAintergenicDe novo--Yuen2017 G
CLEC14A     2-1280-003chr14:
38864836-38864836
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More