or
or
Exact

Results for "CTNNA2"

Variant Events: 103

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CTNNA2     2-0310-004chr2:
80123193-80123193
GAintronicDe novo--Yuen2017 G
CTNNA2     AU4452302chr2:
80862488-80862488
TCintronicDe novo--Yuen2017 G
CTNNA2     1-0352-005chr2:
80874634-80874634
CTintronicDe novo--Yuen2017 G
CTNNA2     7-0253-003chr2:
81599436-81599436
AGintergenicDe novo--Yuen2017 G
CTNNA2     2-0309-004chr2:
79846098-79846098
GCintronicDe novo--Yuen2017 G
CTNNA2     13692.p1chr2:
81308236-81308236
CGintergenicDe novo--Werling2018 G
CTNNA2     2-0309-004chr2:
80591223-80591223
GAintronicDe novo--Yuen2017 G
CTNNA2     AU002903chr2:
80290256-80290256
CTintronicDe novo--Yuen2017 G
CTNNA2     7-0248-003chr2:
81357232-81357232
AGintergenicDe novo--Yuen2017 G
CTNNA2     1-0556-003chr2:
80397355-80397360
CTCTGTCTintronicDe novo--Yuen2017 G
CTNNA2     2-1356-003chr2:
80402822-80402822
GTintronicDe novo--Yuen2016 G
Yuen2017 G
CTNNA2     AU054304chr2:
80791429-80791429
CTintronicDe novo--Yuen2017 G
CTNNA2     1-0534-006chr2:
81247359-81247368
GTGAGTTATTGintergenicDe novo--Yuen2017 G
CTNNA2     1-0054-004chr2:
80852486-80852486
TAintronicDe novo--Yuen2017 G
CTNNA2     AU2075301chr2:
80808939-80808939
GAexonicDe novononsynonymous SNVNM_001282599
NM_001282600
NM_001164883
NM_001282597
NM_001282598
NM_004389
c.G1039A
c.G898A
c.G2002A
c.G2002A
c.G2104A
c.G2002A
p.A347T
p.A300T
p.A668T
p.A668T
p.A702T
p.A668T
21.38.351E-6Yuen2017 G
CTNNA2     AU4067303chr2:
79967396-79967396
AGintronicDe novo--Yuen2017 G
CTNNA2     2-1415-004chr2:
79960221-79960221
CGintronicDe novo--Yuen2017 G
CTNNA2     2-1505-004chr2:
80731656-80731656
GAintronicDe novo--Yuen2017 G
CTNNA2     2-1381-003chr2:
80196330-80196330
CAintronicDe novo--Yuen2017 G
CTNNA2     2-0289-004chr2:
79865651-79865651
CTintronicDe novo--Yuen2017 G
CTNNA2     2-1429-003chr2:
80890963-80890963
CTintergenicDe novo--Yuen2017 G
CTNNA2     AU072505chr2:
80880003-80880003
CGintergenicDe novo--Yuen2017 G
CTNNA2     5-0015-004chr2:
79789019-79789019
TCintronicDe novo--Yuen2017 G
CTNNA2     2-1317-003chr2:
80397925-80397925
GAintronicDe novo--Yuen2017 G
CTNNA2     1-0609-003chr2:
81235327-81235327
CGintergenicDe novo--Yuen2017 G
CTNNA2     A10chr2:
81384457-81384457
GAintergenicDe novo--Wu2018 G
CTNNA2     1-0701-003chr2:
80747044-80747044
GAintronicDe novo--Yuen2017 G
CTNNA2     7-0082-003chr2:
81494582-81494582
AGintergenicDe novo--Yuen2017 G
CTNNA2     AU1860302chr2:
79907163-79907163
GCintronicDe novo--Yuen2017 G
CTNNA2     AU1940304chr2:
80576963-80576963
CTintronicDe novo--Yuen2017 G
CTNNA2     AU1940304chr2:
80603745-80603745
AGintronicDe novo--Yuen2017 G
CTNNA2     1-0274-004chr2:
80503886-80503886
AGintronicDe novo--Yuen2017 G
CTNNA2     7-0127-003chr2:
81385865-81385865
GTintergenicDe novo--Yuen2017 G
CTNNA2     AU057503chr2:
80782264-80782264
TGintronicDe novo--Yuen2017 G
CTNNA2     2-0242-003chr2:
80183979-80183979
TTCintronicDe novo--Yuen2017 G
CTNNA2     2-1368-003chr2:
80442752-80442752
CTintronicDe novo--Yuen2016 G
CTNNA2     2-1169-003chr2:
81187192-81187192
CTintergenicDe novo--Yuen2017 G
CTNNA2     AU4343302chr2:
81207226-81207226
TGintergenicDe novo--Yuen2017 G
CTNNA2     1-0509-003chr2:
80319225-80319225
TAintronicDe novo--Yuen2016 G
Yuen2017 G
CTNNA2     1-0153-004chr2:
80138581-80138585
CTAAACintronicDe novo--Yuen2017 G
CTNNA2     1-0352-003chr2:
80874634-80874634
CTintronicDe novo--Yuen2016 G
CTNNA2     2-1223-003chr2:
80781360-80781373
CTCTTTCTTTCTTTCTCTTTCTTTintronicDe novo--Yuen2017 G
CTNNA2     2-1353-003chr2:
80923746-80923746
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
CTNNA2     AU051504chr2:
81655955-81655978
TTCCACTCCACTCCACTCCACTCCTTCCACTCCACTCCACTCCintergenicDe novo--Yuen2017 G
CTNNA2     AU017703chr2:
80228195-80228195
GAintronicDe novo--Yuen2017 G
CTNNA2     2-1365-003chr2:
80439435-80439435
ATintronicDe novo--Yuen2016 G
Yuen2017 G
CTNNA2     AU027506chr2:
81514152-81514152
ATintergenicDe novo--Yuen2017 G
CTNNA2     AU2437302chr2:
79874777-79874777
GAintronicDe novo--Yuen2017 G
CTNNA2     1-0201-004chr2:
81219019-81219019
CAintergenicDe novo--Yuen2017 G
CTNNA2     7-0161-003chr2:
79902770-79902770
CTintronicDe novo--Yuen2017 G
CTNNA2     1-0373-003chr2:
80471272-80471272
TCintronicDe novo--Yuen2017 G
CTNNA2     7-0253-004chr2:
81668725-81668725
CTintergenicDe novo--Yuen2017 G
CTNNA2     1-0572-003chr2:
80502839-80502856
AAGAGAGAGAGAGAGAGAAAGAGAGAGAGAGAGAintronicDe novo--Yuen2017 G
CTNNA2     5-0133-003chr2:
80111874-80111874
AGintronicDe novo--Yuen2017 G
CTNNA2     AU2793301chr2:
81205696-81205696
CTintergenicDe novo--Yuen2017 G
CTNNA2     2-1506-003chr2:
80192819-80192819
GAintronicDe novo--Yuen2017 G
CTNNA2     5-0106-003chr2:
80759820-80759820
GTintronicDe novo--Yuen2017 G
CTNNA2     AU4310301chr2:
80836904-80836904
CTintronicDe novo--Yuen2017 G
CTNNA2     AU4444304chr2:
80733464-80733466
AGGAGintronicDe novo--Yuen2017 G
CTNNA2     1-0551-003chr2:
80938915-80938915
TCintergenicDe novo--Yuen2017 G
CTNNA2     AU063004chr2:
80963901-80963901
TCintergenicDe novo--Yuen2017 G
CTNNA2     1-0285-004chr2:
79763808-79763808
TTGintronicDe novo--Yuen2017 G
CTNNA2     AU4429301chr2:
80223480-80223480
AGintronicDe novo--Yuen2017 G
CTNNA2     1-0595-005chr2:
80935753-80935753
CTintergenicDe novo--Yuen2017 G
CTNNA2     2-1292-004chr2:
80565597-80565597
ATintronicDe novo--Yuen2017 G
CTNNA2     2-1341-004chr2:
80565095-80565101
AGAAAGGAintronicDe novo--Yuen2017 G
CTNNA2     7-0171-003chr2:
81165209-81165209
GCintergenicDe novo--Yuen2017 G
CTNNA2     AU3801301chr2:
79752430-79752430
GAintronicDe novo--Yuen2017 G
CTNNA2     1-0347-003chr2:
81253845-81253845
TGintergenicDe novo--Yuen2017 G
CTNNA2     AU011704chr2:
80847448-80847448
CTintronicDe novo--Yuen2017 G
CTNNA2     1-0303-004chr2:
81636151-81636151
CGintergenicDe novo--Yuen2017 G
CTNNA2     1-0303-004chr2:
80836168-80836168
TCintronicDe novo--Yuen2017 G
CTNNA2     AU2293301chr2:
79897561-79897561
GCintronicDe novo--Yuen2017 G
CTNNA2     AU4067301chr2:
79890310-79890310
GTintronicDe novo--Yuen2017 G
CTNNA2     1-0446-003chr2:
81360630-81360630
AGintergenicDe novo--Yuen2017 G
CTNNA2     2-1169-004chr2:
80614090-80614090
GAintronicDe novo--Yuen2017 G
CTNNA2     2-1252-003chr2:
80765014-80765014
GAintronicDe novo--Yuen2017 G
CTNNA2     AU3399302chr2:
80258646-80258646
CTintronicDe novo--Yuen2017 G
CTNNA2     2-1169-004chr2:
80902387-80902387
GTintergenicDe novo--Yuen2017 G
CTNNA2     AU3951302chr2:
80362451-80362451
GAintronicDe novo--Yuen2017 G
CTNNA2     1-0079-008chr2:
80183979-80183979
TTCintronicDe novo--Yuen2017 G
CTNNA2     1-0104-004chr2:
80087680-80087680
TTGTTTTGintronicDe novo--Yuen2017 G
CTNNA2     AU1995302chr2:
80712398-80712398
GCintronicDe novo--Yuen2017 G
CTNNA2     AU1995302chr2:
81009473-81009473
CAintergenicDe novo--Yuen2017 G
CTNNA2     74-0117chr2:
80847448-80847448
CTintronicDe novo--Michaelson2012 G
CTNNA2     AU2793302chr2:
80830540-80830540
TCintronicDe novo--Yuen2017 G
CTNNA2     74-0355chr2:
81033108-81033108
GAintergenicDe novo--Michaelson2012 G
CTNNA2     1-0274-003chr2:
80503886-80503886
AGintronicDe novo--Yuen2017 G
CTNNA2     5-0137-003chr2:
81485065-81485065
ACintergenicDe novo--Yuen2017 G
CTNNA2     1-0751-003chr2:
80552983-80552983
TCintronicDe novo--Yuen2017 G
CTNNA2     2-1148-004chr2:
80979029-80979029
AGintergenicDe novo--Yuen2017 G
CTNNA2     12680.p1chr2:
79808864-79808864
GAintronicDe novo--Turner2016 G
CTNNA2     5-0055-003chr2:
81623749-81623749
CTintergenicDe novo--Yuen2017 G
CTNNA2     AU2129301chr2:
80552017-80552017
CTintronicDe novo--Yuen2017 G
CTNNA2     13874.p1chr2:
81238399-81238399
ACintergenicDe novo--Turner2016 G
CTNNA2     AU3790302chr2:
80357291-80357291
GAintronicDe novo--Yuen2017 G
CTNNA2     1-0708-003chr2:
81660777-81660777
TAintergenicDe novo--Yuen2017 G
CTNNA2     7-0192-003chr2:
81240435-81240435
TCintergenicDe novo--Yuen2017 G
CTNNA2     1-0597-003chr2:
81299201-81299201
TCintergenicDe novo--Yuen2017 G
CTNNA2     AU2029301chr2:
81372349-81372349
AGintergenicDe novo--Yuen2017 G
CTNNA2     AU3343301chr2:
81069729-81069729
GAintergenicDe novo--Yuen2017 G
CTNNA2     AU024607chr2:
81045531-81045531
ATintergenicDe novo--Yuen2017 G
CTNNA2     AU3343301chr2:
81465243-81465243
AGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More