or
or
Exact

Results for "E2F7"

Variant Events: 43

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
E2F7     1-0197-004chr12:
78174304-78174304
GAintergenicDe novo--Yuen2017 G
E2F7     1-0292-005chr12:
78200814-78200814
ATintergenicDe novo--Yuen2017 G
E2F7     2-1341-003chr12:
77452421-77452421
CCAintronicDe novo--Yuen2017 G
E2F7     AU4487302chr12:
78060951-78060951
AGintergenicDe novo--Yuen2017 G
E2F7     1-0508-003chr12:
78066330-78066345
ATGTGTGTGTGTGTGTATGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
E2F7     1-0325-003chr12:
78114101-78114101
GAintergenicDe novo--Yuen2017 G
E2F7     2-1290-004chr12:
78210320-78210320
GTintergenicDe novo--Yuen2017 G
E2F7     2-1518-003chr12:
77957503-77957503
GAintergenicDe novo--Yuen2017 G
E2F7     AU3637301chr12:
78048669-78048669
GTintergenicDe novo--Yuen2017 G
E2F7     5-0014-003chr12:
77513317-77513317
AGintergenicDe novo--Yuen2017 G
E2F7     2-1278-003chr12:
77869349-77869349
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
E2F7     AU3729303chr12:
78057737-78057737
ATintergenicDe novo--Yuen2017 G
E2F7     041-07-107684chr12:
77419315-77419315
CGintronicDe novo--Satterstrom2020 E
E2F7     2-1526-004chr12:
77965043-77965043
GAintergenicDe novo--Yuen2017 G
E2F7     1-0530-003chr12:
78199328-78199328
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
E2F7     1-0567-004chr12:
77426751-77426751
TCintronicDe novo--Yuen2017 G
E2F7     2-1212-003chr12:
77494325-77494325
ACintergenicDe novo--Yuen2017 G
E2F7     SSC02599chr12:
77440061-77440061
GAexonicDe novosynonymous SNVNM_203394c.C586Tp.L196L--Lim2017 E
E2F7     08C75098chr12:
77449880-77449880
CTexonicDe novononsynonymous SNVNM_203394c.G124Ap.A42T12.5-Satterstrom2020 E
E2F7     2-0208-003chr12:
77586005-77586005
GCintergenicDe novo--Yuen2017 G
E2F7     A8chr12:
77680940-77680940
CTintergenicDe novo--Wu2018 G
E2F7     2-1334-003chr12:
78060591-78060591
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
E2F7     AU0146301chr12:
77944497-77944497
AGintergenicDe novo--Yuen2017 G
E2F7     1-0389-004chr12:
77927424-77927427
GGAAGintergenicDe novo--Yuen2017 G
E2F7     5-0018-003chr12:
77444385-77444385
AGexonicDe novononsynonymous SNVNM_203394c.T509Cp.I170T25.0-Yuen2017 G
E2F7     AU075703chr12:
78179778-78179778
AGintergenicDe novo--Yuen2017 G
E2F7     1-0019-004chr12:
78055289-78055289
CTintergenicDe novo--Yuen2017 G
E2F7     5-0146-003chr12:
78172628-78172628
AGintergenicDe novo--Yuen2017 G
E2F7     3-0169-000chr12:
78042637-78042637
CGintergenicDe novo--Yuen2016 G
E2F7     AU3645301chr12:
77579088-77579088
AGintergenicDe novo--Yuen2017 G
E2F7     AU4479301chr12:
78005680-78005680
ATintergenicDe novo--Yuen2017 G
E2F7     7-0055-003chr12:
77771157-77771157
CTintergenicDe novo--Yuen2017 G
E2F7     1-0973-003chr12:
77562301-77562301
GCintergenicDe novo--Yuen2017 G
E2F7     AU063004chr12:
78146996-78146996
CTintergenicDe novo--Yuen2017 G
E2F7     2-1357-004chr12:
77882238-77882238
GAintergenicDe novo--Yuen2017 G
E2F7     AU063004chr12:
78148021-78148022
GCGintergenicDe novo--Yuen2017 G
E2F7     1-0259-005chr12:
77553380-77553380
GAintergenicDe novo--Yuen2017 G
E2F7     1-0569-003chr12:
78217038-78217053
CAGAGAGAGAGAGAGACAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
E2F7     AU063004chr12:
78149847-78149847
GAintergenicDe novo--Yuen2017 G
E2F7     11002.p1chr12:
78047980-78047980
TCintergenicDe novo--Turner2016 G
E2F7     AU2108302chr12:
77990864-77990864
TGintergenicDe novo--Yuen2017 G
E2F7     11417.p1chr12:
77440061-77440061
GAexonicMosaic, De novosynonymous SNVNM_203394c.C586Tp.L196L--Dou2017 E
Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
E2F7     74-0265 Complex Event; expand row to view variants  De novo--Michaelson2012 G
Michaelson2012 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More