or
or
Exact

Results for "TMEM182"

Variant Events: 89

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TMEM182     2-1561-003chr2:
104341756-104341756
GTintergenicDe novo--Yuen2017 G
TMEM182     AU4072303chr2:
104577747-104577747
GAintergenicDe novo--Yuen2017 G
TMEM182     2-1345-003chr2:
104291290-104291290
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
TMEM182     2-1567-004chr2:
104906801-104906801
GAintergenicDe novo--Yuen2017 G
TMEM182     2-1509-003chr2:
103586349-103586349
AGintergenicDe novo--Yuen2017 G
TMEM182     AU1355301chr2:
103586613-103586614
CACAAintergenicDe novo--Yuen2017 G
TMEM182     2-1456-004chr2:
103561597-103561601
CTCTTCintergenicDe novo--Yuen2017 G
TMEM182     5-0014-003chr2:
103778378-103778378
CTintergenicDe novo--Yuen2017 G
TMEM182     1-0745-003chr2:
104504604-104504604
CTintergenicDe novo--Yuen2017 G
TMEM182     2-1146-003chr2:
104920987-104920987
CTintergenicDe novo--Yuen2017 G
TMEM182     AU4054302chr2:
103674583-103674583
TCintergenicDe novo--Yuen2017 G
TMEM182     3-0246-000chr2:
104841683-104841683
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
TMEM182     2-0182-003chr2:
104202327-104202327
GGAAintergenicDe novo--Yuen2017 G
TMEM182     2-1302-003chr2:
104908725-104908725
TCintergenicDe novo--Yuen2017 G
TMEM182     AU1764301chr2:
103725914-103725914
TCintergenicDe novo--Yuen2017 G
TMEM182     2-1315-003chr2:
104105675-104105675
CTintergenicDe novo--Yuen2017 G
TMEM182     7-0197-003chr2:
104311014-104311014
GTintergenicDe novo--Yuen2017 G
TMEM182     AU4235301chr2:
104621294-104621294
GAintergenicDe novo--Yuen2017 G
TMEM182     1-0022-003chr2:
103713476-103713476
GAintergenicDe novo--Yuen2016 G
TMEM182     1-0285-004chr2:
104246099-104246099
CTintergenicDe novo--Yuen2017 G
TMEM182     1-0144-004chr2:
103833313-103833313
GGACTTintergenicDe novo--Yuen2017 G
TMEM182     AU4029302chr2:
104409669-104409676
TGTATTAGTGTATTAGGTATTAGintergenicDe novo--Yuen2017 G
TMEM182     1-0255-003chr2:
104575639-104575639
GAintergenicDe novo--Yuen2017 G
TMEM182     1-0299-004chr2:
104798201-104798201
TCintergenicDe novo--Yuen2017 G
TMEM182     AU4032307chr2:
104714003-104714003
CTintergenicDe novo--Yuen2017 G
TMEM182     AU4235301chr2:
103504438-103504438
GAintergenicDe novo--Yuen2017 G
TMEM182     2-1398-003chr2:
104219006-104219006
CAintergenicDe novo--Yuen2017 G
TMEM182     2-1398-003chr2:
103603250-103603250
GAintergenicDe novo--Yuen2017 G
TMEM182     1-0261-003chr2:
104955820-104955820
GCintergenicDe novo--Yuen2017 G
TMEM182     1-0382-003chr2:
103978693-103978693
AATTintergenicDe novo--Yuen2017 G
TMEM182     2-1265-003chr2:
103501822-103501822
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
TMEM182     5-0131-003chr2:
104955225-104955225
CTintergenicDe novo--Yuen2017 G
TMEM182     2-1261-004chr2:
104221143-104221143
GAintergenicDe novo--Yuen2017 G
TMEM182     2-1335-004chr2:
104425099-104425099
GAintergenicDe novo--Yuen2017 G
TMEM182     7-0141-003chr2:
104433416-104433416
GAintergenicDe novo--Yuen2017 G
TMEM182     2-0214-004chr2:
104895388-104895388
CAintergenicDe novo--Yuen2017 G
TMEM182     2-1475-003chr2:
104010188-104010189
GAGintergenicDe novo--Yuen2017 G
TMEM182     2-0142-003chr2:
104339595-104339595
GGAintergenicDe novo--Yuen2017 G
TMEM182     AU2140306chr2:
103874082-103874082
CTintergenicDe novo--Yuen2017 G
TMEM182     AU2123301chr2:
104005947-104005947
GCintergenicDe novo--Yuen2017 G
TMEM182     AU3794301chr2:
104233791-104233791
AGintergenicDe novo--Yuen2017 G
TMEM182     AU1725306chr2:
104518457-104518457
CAintergenicDe novo--Yuen2017 G
TMEM182     AU3866301chr2:
104531024-104531024
GTintergenicDe novo--Yuen2017 G
TMEM182     1-0226-005chr2:
104095501-104095501
GAintergenicDe novo--Yuen2017 G
TMEM182     AU076705chr2:
103732770-103732770
CTintergenicDe novo--Yuen2017 G
TMEM182     2-1397-003chr2:
104456164-104456164
GAintergenicDe novo--Yuen2017 G
TMEM182     AU4089301chr2:
103741901-103741901
TAintergenicDe novo--Yuen2017 G
TMEM182     2-1456-003chr2:
103561597-103561601
CTCTTCintergenicDe novo--Yuen2017 G
TMEM182     AU054303chr2:
104864256-104864256
AGintergenicDe novo--Yuen2017 G
TMEM182     2-1386-003chr2:
104167302-104167302
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
TMEM182     2-1407-003chr2:
104574333-104574333
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
TMEM182     5-0071-003chr2:
104828142-104828142
ACintergenicDe novo--Yuen2017 G
TMEM182     AU048206chr2:
104665451-104665451
TGintergenicDe novo--Yuen2017 G
TMEM182     1-0486-003chr2:
103384047-103384047
CTintronicDe novo--Yuen2017 G
TMEM182     iHART3149chr2:
103414355-103414356
TGTexonicPaternalframeshift deletionNM_144632c.366delGp.L122fs--Ruzzo2019 G
TMEM182     AU3787303chr2:
103925022-103925022
GAintergenicDe novo--Yuen2017 G
TMEM182     2-0057-004chr2:
103392906-103392906
CTintronicDe novo--Yuen2017 G
TMEM182     AU0636303chr2:
103417048-103417048
TGintronicDe novo--Yuen2017 G
TMEM182     1-0022-004chr2:
103713476-103713476
GAintergenicDe novo--Yuen2017 G
TMEM182     AU031404chr2:
103537430-103537434
CAAAACAAintergenicDe novo--Yuen2017 G
TMEM182     1-0627-005chr2:
104687210-104687210
ATintergenicDe novo--Yuen2017 G
TMEM182     1-0559-005chr2:
103478470-103478470
GAintergenicDe novo--Yuen2017 G
TMEM182     AU3765302chr2:
104151736-104151736
TCintergenicDe novo--Yuen2017 G
TMEM182     3-0134-000chr2:
103649392-103649392
AGintergenicDe novo--Yuen2017 G
TMEM182     1-0232-004chr2:
104875602-104875602
CTintergenicDe novo--Yuen2017 G
TMEM182     AU4092302chr2:
104048632-104048632
CGintergenicDe novo--Yuen2017 G
TMEM182     AU3263302chr2:
104115146-104115146
GAintergenicDe novo--Yuen2017 G
TMEM182     1-0144-005chr2:
103833313-103833313
GGACTTintergenicDe novo--Yuen2017 G
TMEM182     5-0128-003chr2:
103692970-103692970
TGintergenicDe novo--Yuen2017 G
TMEM182     2-1291-003chr2:
103685578-103685578
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
TMEM182     AU3716301chr2:
104322519-104322519
GAintergenicDe novo--Yuen2017 G
TMEM182     AU3937301chr2:
103739740-103739740
GAintergenicDe novo--Yuen2017 G
TMEM182     60-2027chr2:
103451691-103451691
CTintergenicDe novo--Michaelson2012 G
TMEM182     AU3885304chr2:
103933330-103933330
GAintergenicDe novo--Yuen2017 G
TMEM182     1-0835-003chr2:
104552051-104552054
CTGTCTintergenicDe novo--Yuen2017 G
TMEM182     2-1277-003chr2:
104202372-104202372
AAGGintergenicDe novo--Yuen2017 G
TMEM182     AU017703chr2:
104248342-104248342
GAintergenicDe novo--Yuen2017 G
TMEM182     2-1626-003chr2:
103927577-103927578
TATAAintergenicDe novo--Yuen2017 G
TMEM182     1-0439-003chr2:
103977467-103977483
TACACACACACACACACTACACACACACACACintergenicDe novo--Yuen2017 G
TMEM182     7-0100-004chr2:
104822217-104822217
TCintergenicDe novo--Yuen2017 G
TMEM182     2-0129-004chr2:
104966179-104966197
AATAGAACAAATTCTTGATAintergenicDe novo--Yuen2017 G
TMEM182     1-0271-004chr2:
104771647-104771647
AGintergenicDe novo--Yuen2017 G
TMEM182     5-0003-004chr2:
104935956-104935956
GAintergenicDe novo--Yuen2017 G
TMEM182     5-0133-003chr2:
104104052-104104052
GTintergenicDe novo--Yuen2017 G
TMEM182     AU046706chr2:
103629389-103629389
CTintergenicDe novo--Yuen2017 G
TMEM182     2-0022-003chr2:
104141075-104141075
AGintergenicDe novo--Yuen2017 G
TMEM182     AU011903chr2:
103976895-103976895
GCintergenicDe novo--Yuen2017 G
TMEM182     2-1452-003chr2:
104663632-104663632
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
TMEM182     1-0683-004chr2:
104616254-104616254
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More