or
or
Exact

Results for "AGBL1"

Variant Events: 92

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
AGBL1     AU030804chr15:
86944298-86944298
CTintronicDe novo--Yuen2017 G
AGBL1     2-1399-003chr15:
88051840-88051840
ACintergenicDe novo--Yuen2017 G
AGBL1     2-1280-003chr15:
86735401-86735413
GCACACACACACAGCACACACACAintronicDe novo--Yuen2017 G
AGBL1     NDAR_INVGH325XTH_wes1chr15:
86791126-86791126
ATintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
AGBL1     1-0417-003chr15:
87357268-87357268
CTintronicDe novo--Yuen2016 G
Yuen2017 G
AGBL1     1-0203-003chr15:
86928730-86928730
GCintronicDe novo--Yuen2017 G
AGBL1     AU4145303chr15:
86784063-86784063
CTintronicDe novo--Yuen2017 G
AGBL1     1-0203-003chr15:
86923672-86923672
GCintronicDe novo--Yuen2017 G
AGBL1     1-0203-003chr15:
86922492-86922492
TCintronicDe novo--Yuen2017 G
AGBL1     1-0674-003chr15:
87438854-87438854
CTintronicDe novo--Yuen2017 G
AGBL1     1-0699-003chr15:
87047083-87047083
GCintronicDe novo--Yuen2017 G
AGBL1     13515.p1chr15:
86753743-86753743
GAintronicDe novo--Turner2016 G
AGBL1     AU4394302chr15:
88045655-88045655
AGintergenicDe novo--Yuen2017 G
AGBL1     1-0918-003chr15:
87565790-87565790
TCintronicDe novo--Yuen2017 G
AGBL1     2-1086-004chr15:
87676268-87676268
GAintergenicDe novo--Yuen2017 G
AGBL1     2-1182-003chr15:
87084682-87084682
GAintronicDe novo--Yuen2016 G
Yuen2017 G
AGBL1     AU2162302chr15:
86795520-86795520
CGintronicDe novo--Yuen2017 G
AGBL1     14637.p1chr15:
87710829-87710829
GAintergenicDe novo--Turner2016 G
AGBL1     AU3777302chr15:
87083587-87083587
GAintronicDe novo--Yuen2017 G
AGBL1     5-0087-003chr15:
86958441-86958441
TCintronicDe novo--Yuen2017 G
AGBL1     AU066104chr15:
87324087-87324087
CTintronicDe novo--Yuen2017 G
AGBL1     2-1184-003chr15:
87206324-87206324
CTintronicDe novo--Yuen2016 G
Yuen2017 G
AGBL1     AU2140305chr15:
87278972-87278972
TAintronicDe novo--Yuen2017 G
AGBL1     1-0224-004chr15:
88052733-88052733
TAintergenicDe novo--Yuen2017 G
AGBL1     2-0202-004chr15:
87561232-87561232
AGintronicDe novo--Yuen2017 G
AGBL1     AU031004chr15:
88088129-88088129
CGintergenicDe novo--Yuen2017 G
AGBL1     AU054103chr15:
86935365-86935365
TCintronicDe novo--Yuen2017 G
AGBL1     AU006804chr15:
87667223-87667223
ATintergenicDe novo--Yuen2017 G
AGBL1     1-0567-004chr15:
87985837-87985839
CAGCintergenicDe novo--Yuen2017 G
AGBL1     2-1242-003chr15:
87293270-87293270
ATintronicDe novo--Yuen2017 G
AGBL1     2-0007-003chr15:
87631571-87631571
CTintergenicDe novo--Yuen2017 G
AGBL1     1-0372-003chr15:
86750732-86750732
GAintronicDe novo--Yuen2016 G
Yuen2017 G
AGBL1     AU079204chr15:
86726222-86726222
GAintronicDe novo--Yuen2017 G
AGBL1     AU079204chr15:
87773293-87773293
CTintergenicDe novo--Yuen2017 G
AGBL1     1-0579-003chr15:
87190881-87190881
GAintronicDe novo--Yuen2017 G
AGBL1     AU072004chr15:
87801668-87801668
CTintergenicDe novo--Yuen2017 G
AGBL1     Li2017:19690chr15:
86940602-86940602
CAexonicUnknownnonsynonymous SNVNM_152336c.C2242Ap.R748S24.78.764E-6Li2017 T
AGBL1     1-0402-004chr15:
87251463-87251464
AGAintronicDe novo--Yuen2017 G
AGBL1     2-1213-003chr15:
87592721-87592721
CAintergenicDe novo--Yuen2017 G
AGBL1     AU3057301chr15:
87343421-87343421
GCintronicDe novo--Yuen2017 G
AGBL1     1-0668-003chr15:
87004769-87004769
TAintronicDe novo--Yuen2017 G
AGBL1     AU3124304chr15:
87394209-87394209
CTintronicDe novo--Yuen2017 G
AGBL1     5-0055-003chr15:
86944880-86944880
GTintronicDe novo--Yuen2017 G
AGBL1     7-0135-003chr15:
87370134-87370134
CTintronicDe novo--Yuen2017 G
AGBL1     1-0045-003chr15:
86811066-86811066
CGintronicDe novo--Yuen2017 G
AGBL1     Li2017:18chr15:
86791030-86791031
AGAexonicUnknownframeshift deletionNM_152336c.518delGp.R173fs--Li2017 T
AGBL1     1-0448-003chr15:
87098737-87098737
GAintronicDe novo--Yuen2017 G
AGBL1     2-0215-003chr15:
86805007-86805007
CTintronicDe novo--Yuen2017 G
AGBL1     5-0033-004chr15:
88067606-88067606
TCintergenicDe novo--Yuen2017 G
AGBL1     Li2017:24chr15:
86807692-86807692
CCAexonicUnknownframeshift insertionNM_152336c.1153dupAp.S384fs-1.0E-4Li2017 T
AGBL1     AU005214chr15:
87161164-87161164
ATintronicDe novo--Yuen2017 G
AGBL1     1-0323-004chr15:
87946691-87946691
CTintergenicDe novo--Yuen2017 G
AGBL1     2-1296-003chr15:
87525291-87525291
AGintronicDe novo--Yuen2017 G
AGBL1     2-1296-003chr15:
87340845-87340845
ATintronicDe novo--Yuen2017 G
AGBL1     AU3790301chr15:
87392585-87392585
CTintronicDe novo--Yuen2017 G
AGBL1     2-1373-003chr15:
86897347-86897347
GTintronicDe novo--Yuen2016 G
Yuen2017 G
AGBL1     2-1417-003chr15:
86839308-86839308
CTintronicDe novo--Yuen2017 G
AGBL1     AU4273304chr15:
87322090-87322090
GAintronicDe novo--Yuen2017 G
AGBL1     1-0160-004chr15:
87498234-87498234
AGintronicDe novo--Yuen2017 G
AGBL1     AU027506chr15:
87878190-87878190
CAintergenicDe novo--Yuen2017 G
AGBL1     AU4032307chr15:
87065723-87065723
AGintronicDe novo--Yuen2017 G
AGBL1     1-0965-003chr15:
87657015-87657015
AGintergenicDe novo--Yuen2017 G
AGBL1     AU026604chr15:
87881104-87881104
GTintergenicDe novo--Yuen2017 G
AGBL1     AU4327303chr15:
86821546-86821546
AGintronicDe novo--Yuen2017 G
AGBL1     1-0075-003chr15:
86998774-86998774
TCintronicDe novo--Yuen2017 G
AGBL1     5-0131-003chr15:
88051842-88051842
CAintergenicDe novo--Yuen2017 G
AGBL1     3-0431-000chr15:
87259830-87259830
GTintronicDe novo--Yuen2016 G
Yuen2017 G
AGBL1     2-0289-004chr15:
86971135-86971135
CTintronicDe novo--Yuen2017 G
AGBL1     2-1094-005chr15:
88106759-88106759
ACintergenicDe novo--Yuen2017 G
AGBL1     2-1094-005chr15:
86878098-86878098
CTintronicDe novo--Yuen2017 G
AGBL1     1-0408-003chr15:
87332013-87332013
CTintronicDe novo--Yuen2017 G
AGBL1     AU038204chr15:
88053275-88053275
CTintergenicDe novo--Yuen2017 G
AGBL1     AU2495302chr15:
87249877-87249877
CTintronicDe novo--Yuen2017 G
AGBL1     1-0388-003chr15:
86835704-86835704
CAintronicDe novo--Yuen2017 G
AGBL1     1-0585-003chr15:
87123863-87123863
TCintronicDe novo--Yuen2017 G
AGBL1     AU4410302chr15:
87948259-87948259
CGintergenicDe novo--Yuen2017 G
AGBL1     AU3808304chr15:
87108233-87108233
CGintronicDe novo--Yuen2017 G
AGBL1     2-0007-004chr15:
87592449-87592449
TCintergenicDe novo--Yuen2017 G
AGBL1     2-1180-003chr15:
86744794-86744794
CTintronicDe novo--Yuen2016 G
Yuen2017 G
AGBL1     1-0558-003chr15:
86918033-86918033
CAintronicDe novo--Yuen2017 G
AGBL1     AU1668302chr15:
87309554-87309554
CTintronicDe novo--Yuen2017 G
AGBL1     AU1668302chr15:
87793558-87793558
GAintergenicDe novo--Yuen2017 G
AGBL1     1-0556-003chr15:
87830105-87830114
GTCATTCATTGTCATTintergenicDe novo--Yuen2017 G
AGBL1     AU007503chr15:
88062116-88062116
GAintergenicDe novo--Yuen2017 G
AGBL1     2-1427-003chr15:
87511667-87511667
TAintronicDe novo--Yuen2017 G
AGBL1     74-0075chr15:
88062116-88062116
GAintergenicDe novo--Michaelson2012 G
AGBL1     Li2017:18907chr15:
86791030-86791031
AGAexonicUnknownframeshift deletionNM_152336c.518delGp.R173fs--Li2017 T
AGBL1     A27chr15:
86807700-86807700
AAAexonicDe novoframeshift insertionNM_152336c.1160dupAp.N387fs--Wu2018 G
AGBL1     AU4168306chr15:
87438177-87438177
AGintronicDe novo--Yuen2017 G
AGBL1     A15chr15:
86791031-86791032
GGGexonicDe novoframeshift deletionNM_152336c.519delGp.R173fs--Wu2018 G
AGBL1     AU4463303chr15:
87843300-87843300
CTintergenicDe novo--Yuen2017 G
AGBL1     Li2017:18911chr15:
86807692-86807692
CCAexonicUnknownframeshift insertionNM_152336c.1153dupAp.S384fs-1.0E-4Li2017 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More