or
or
Exact

Results for "TMEM132D"

Variant Events: 55

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TMEM132D     AU2022302chr12:
130145138-130145138
AGintronicDe novo--Yuen2017 G
TMEM132D     1-0079-008chr12:
130212290-130212290
GAintronicDe novo--Yuen2017 G
TMEM132D     1-0404-003chr12:
130306044-130306044
GAintronicDe novo--Yuen2017 G
TMEM132D     1-0464-003chr12:
129677454-129677454
GAintronicDe novo--Yuen2017 G
TMEM132D     3-0396-000chr12:
129839690-129839690
GAintronicDe novo--Yuen2016 G
TMEM132D     1-0022-004chr12:
129873418-129873418
ATintronicDe novo--Yuen2017 G
TMEM132D     1-0022-004chr12:
129873415-129873415
GAintronicDe novo--Yuen2017 G
TMEM132D     2-0063-005chr12:
130485319-130485319
CTintergenicDe novo--Yuen2017 G
TMEM132D     2-1605-004chr12:
130459649-130459649
AAAAACintergenicDe novo--Yuen2017 G
TMEM132D     AU072504chr12:
129714893-129714893
CAintronicDe novo--Yuen2017 G
TMEM132D     1-0395-004chr12:
130056138-130056138
ATintronicDe novo--Yuen2017 G
TMEM132D     AU3371303chr12:
129961360-129961360
GAintronicDe novo--Yuen2017 G
TMEM132D     AU050403chr12:
129943083-129943083
AGintronicDe novo--Yuen2017 G
TMEM132D     1-0625-003chr12:
130458583-130458583
GAintergenicDe novo--Yuen2017 G
TMEM132D     5-0017-004chr12:
129909831-129909831
CTintronicDe novo--Yuen2017 G
TMEM132D     AU4028302chr12:
130170778-130170786
CTTGAATTGCTTGintronicDe novo--Yuen2017 G
TMEM132D     AU072905chr12:
130435954-130435954
CAintergenicDe novo--Yuen2017 G
TMEM132D     1-0045-003chr12:
129905565-129905565
GTintronicDe novo--Yuen2017 G
TMEM132D     1-0019-004chr12:
130378968-130378968
AGintronicDe novo--Yuen2017 G
TMEM132D     5-0099-003chr12:
130264374-130264374
GCintronicDe novo--Yuen2017 G
TMEM132D     2-1322-004chr12:
130400777-130400777
GAintergenicDe novo--Yuen2017 G
TMEM132D     14153.p1chr12:
130439149-130439149
AGintergenicDe novo--Turner2016 G
TMEM132D     2-0323-004chr12:
129574091-129574091
CCGintronicDe novo--Yuen2017 G
TMEM132D     1-0373-003chr12:
129874263-129874263
CGintronicDe novo--Yuen2017 G
TMEM132D     2-1348-003chr12:
130020856-130020856
GTintronicDe novo--Yuen2017 G
TMEM132D     1-0395-003chr12:
130056138-130056138
ATintronicDe novo--Yuen2017 G
TMEM132D     74-0355chr12:
129581774-129581774
CTintronicDe novo--Michaelson2012 G
TMEM132D     AU4412302chr12:
130464613-130464613
GAintergenicDe novo--Yuen2017 G
TMEM132D     2-0003-004chr12:
130435547-130435547
GAintergenicDe novo--Yuen2017 G
TMEM132D     63-449chr12:
129763346-129763346
CTintronicDe novo--Michaelson2012 G
TMEM132D     2-1581-003chr12:
129568016-129568016
GAintronicDe novo--Yuen2017 G
TMEM132D     7-0058-003chr12:
130074047-130074047
AAGTATintronicDe novo--Yuen2017 G
TMEM132D     AU3637301chr12:
130502998-130502998
CAintergenicDe novo--Yuen2017 G
TMEM132D     5-0138-003chr12:
130304917-130304917
CTintronicDe novo--Yuen2017 G
TMEM132D     1-0976-003chr12:
130401786-130401786
CTintergenicDe novo--Yuen2017 G
TMEM132D     AU3849302chr12:
130182765-130182765
GTintronicDe novo--Yuen2017 G
TMEM132D     AU2975302chr12:
129738636-129738636
CTintronicDe novo--Yuen2017 G
TMEM132D     2-0127-004chr12:
130326033-130326033
TCintronicDe novo--Yuen2017 G
TMEM132D     AU039305chr12:
130429901-130429901
GAintergenicDe novo--Yuen2017 G
TMEM132D     AU3637301chr12:
130283849-130283849
ATintronicDe novo--Yuen2017 G
TMEM132D     1-0896-003chr12:
129637937-129637937
ATintronicDe novo--Yuen2017 G
TMEM132D     1-0214-003chr12:
130235440-130235440
TGintronicDe novo--Yuen2017 G
TMEM132D     2-1381-003chr12:
130214562-130214562
CGintronicDe novo--Yuen2017 G
TMEM132D     1-0558-003chr12:
130134481-130134496
ATGTGTGTGTGTGTGTATGTGTGTGTGTGTintronicDe novo--Yuen2017 G
TMEM132D     AU048206chr12:
129772372-129772372
GTintronicDe novo--Yuen2017 G
TMEM132D     2-1322-003chr12:
130400777-130400777
GAintergenicDe novo--Yuen2017 G
TMEM132D     AU009805chr12:
129816853-129816853
CTintronicDe novo--Yuen2017 G
TMEM132D     2-1129-003chr12:
129873332-129873338
GATAATAGATAintronicDe novo--Yuen2017 G
TMEM132D     1-0025-004chr12:
129774862-129774862
TCintronicDe novo--Yuen2017 G
TMEM132D     1-0354-003chr12:
129998406-129998406
GAintronicDe novo--Yuen2017 G
TMEM132D     2-0002-005chr12:
130267805-130267805
TCintronicDe novo--Yuen2017 G
TMEM132D     1-0206-004chr12:
130326773-130326773
GAintronicDe novo--Yuen2017 G
TMEM132D     1-0559-005chr12:
130277334-130277334
GAintronicDe novo--Yuen2017 G
TMEM132D     1-0701-003chr12:
129743481-129743481
ACintronicDe novo--Yuen2017 G
TMEM132D     AU0146302chr12:
130110789-130110789
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More