or
or
Exact

Results for "TMEM132B"

Variant Events: 36

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TMEM132B     1-0329-004chr12:
126043598-126043598
GAintronicDe novo--Yuen2017 G
TMEM132B     7-0104-003chr12:
126201961-126201961
GCintergenicDe novo--Yuen2017 G
TMEM132B     60-2027chr12:
126210830-126210830
GAintergenicDe novo--Michaelson2012 G
TMEM132B     AU0636303chr12:
126275231-126275231
GTintergenicDe novo--Yuen2017 G
TMEM132B     AU1725302chr12:
126323014-126323014
CTintergenicDe novo--Yuen2017 G
TMEM132B     AU4327303chr12:
126182829-126182829
CTintergenicDe novo--Yuen2017 G
TMEM132B     2-1288-003chr12:
126033496-126033496
CTintronicDe novo--Yuen2017 G
TMEM132B     7-0095-003chr12:
125877969-125877969
CTintronicDe novo--Yuen2017 G
TMEM132B     AU006804chr12:
126169863-126169863
TCintergenicDe novo--Yuen2017 G
TMEM132B     AU059903chr12:
125889818-125889832
GCTCTCTCTCTCTCTGCTCTCTCTCTCTintronicDe novo--Yuen2017 G
TMEM132B     2-1315-003chr12:
126266306-126266306
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
TMEM132B     3-0430-000chr12:
126247209-126247209
CTintergenicDe novo--Yuen2016 G
TMEM132B     AU1933302chr12:
125891480-125891480
GTintronicDe novo--Yuen2017 G
TMEM132B     2-0319-003chr12:
126169830-126169830
CAintergenicDe novo--Yuen2017 G
TMEM132B     1-0004-003chr12:
125952621-125952621
GAintronicDe novo--Yuen2017 G
TMEM132B     7-0249-004chr12:
126120592-126120592
TCintronicDe novo--Yuen2017 G
TMEM132B     AU2793303chr12:
126176782-126176782
AGintergenicDe novo--Yuen2017 G
TMEM132B     AU4093301chr12:
125945939-125945939
CTintronicDe novo--Yuen2017 G
TMEM132B     11380.p1chr12:
125834485-125834486
AGAexonicDe novoframeshift deletionNM_052907c.541delGp.G181fs--Ji2016 E
Krumm2015 E
TMEM132B     7-0129-003chr12:
126007367-126007367
CTintronicDe novo--Yuen2017 G
TMEM132B     AU4093301chr12:
125945946-125945946
AGintronicDe novo--Yuen2017 G
TMEM132B     AC01-0062-01chr12:
126139127-126139127
CTexonicDe novosynonymous SNVNM_001286219
NM_052907
c.C1644T
c.C3108T
p.D548D
p.D1036D
-5.807E-5DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
TMEM132B     2-0006-004chr12:
126173959-126173959
GCintergenicDe novo--Yuen2017 G
TMEM132B     1-0372-003chr12:
126360419-126360419
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
TMEM132B     1-0389-004chr12:
126087374-126087374
AGintronicDe novo--Yuen2017 G
TMEM132B     1-0570-003chr12:
126063901-126063901
CTintronicDe novo--Yuen2017 G
TMEM132B     AU4188302chr12:
126113899-126113899
GAintronicDe novo--Yuen2017 G
TMEM132B     13951.p1chr12:
126414167-126414167
CTintergenicDe novo--Turner2016 G
TMEM132B     12568.p1chr12:
126123734-126123734
TCintronicDe novo--Turner2016 G
TMEM132B     13539.p1chr12:
126397152-126397152
TCintergenicDe novo--Turner2016 G
TMEM132B     1-0065-005chr12:
126291275-126291275
TTTAAGintergenicDe novo--Yuen2017 G
TMEM132B     1-0142-005chr12:
125863282-125863282
GTintronicDe novo--Yuen2017 G
TMEM132B     1-0354-003chr12:
125914348-125914348
CTintronicDe novo--Yuen2017 G
TMEM132B     A17chr12:
126254462-126254462
AAATAintergenicDe novo--Wu2018 G
TMEM132B     1-0559-005chr12:
126068051-126068076
ATTTGAAAAATACTGAAAGGAACTCGAintronicDe novo--Yuen2017 G
TMEM132B     1-0305-004chr12:
125850834-125850834
CGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More