or
or
Exact

Results for "U2AF2"

Variant Events: 7

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
U2AF2     1-0547-003chr19:
56181502-56181502
CTintronicDe novo--Yuen2017 G
U2AF2     ASC_CA_199_Achr19:
56174018-56174018
GAintronicDe novo--Satterstrom2020 E
U2AF2     PN400349chr19:
56170644-56170644
CTexonicUnknownnonsynonymous SNVNM_001012478
NM_007279
c.C118T
c.C118T
p.R40W
p.R40W
18.83.775E-5Leblond2019 E
U2AF2     PN400379chr19:
56166505-56166505
AACGAGAATAAACAAGGTGAGGGCACCGGGGTCGexonicUnknownframeshift insertionNM_001012478
NM_007279
c.35_36insCGAGAATAAACAAGGTGAGGGCACCGGGGTCG
c.35_36insCGAGAATAAACAAGGTGAGGGCACCGGGGTCG
p.N12fs
p.N12fs
-9.756E-5Leblond2019 E
U2AF2     74-0688chr19:
56178954-56178954
CGintronicDe novo--Michaelson2012 G
U2AF2     1-0675-003chr19:
56175713-56175713
GAintronicDe novo--Yuen2017 G
U2AF2     314088chr19:
56170671-56170671
CTexonicUnknownnonsynonymous SNVNM_001012478
NM_007279
c.C145T
c.C145T
p.R49W
p.R49W
15.77-Wang2020 T
Wang2020 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More