or
or
Exact

Results for "FOXN3"

Variant Events: 29

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
FOXN3     1-0119-004chr14:
90160963-90160963
AAAATintergenicDe novo--Yuen2017 G
FOXN3     AU3875301chr14:
89662140-89662140
GCintronicDe novo--Yuen2017 G
FOXN3     Codina-Sola2015:ASD_34chr14:
89629085-89629094
CCCCTCGCTGCexonicMaternalnonframeshift deletionNM_005197
NM_001085471
c.1071_1079del
c.1137_1145del
p.357_360del
p.379_382del
-0.0011Codina-Sola2015 E
FOXN3     2-1317-003chr14:
90107639-90107639
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
FOXN3     2-1266-003chr14:
90123812-90123812
TGintergenicDe novo--Yuen2017 G
FOXN3     2-1189-003chr14:
89652312-89652312
CTintronicDe novo--Yuen2016 G
Yuen2017 G
FOXN3     2-1360-003chr14:
89982228-89982228
GCintronicDe novo--Yuen2016 G
Yuen2017 G
FOXN3     1-0991-003chr14:
89756053-89756053
GAintronicDe novo--Yuen2017 G
FOXN3     2-1486-003chr14:
90070380-90070380
TCintronicDe novo--Yuen2016 G
Yuen2017 G
FOXN3     AU011704chr14:
89853770-89853770
ACintronicDe novo--Yuen2017 G
FOXN3     2-1338-003chr14:
89742858-89742858
GAintronicDe novo--Yuen2017 G
FOXN3     2-1452-003chr14:
90117669-90117686
CCTCTCTCTCTCTCTCTCCCTCTCTCTCTCTCTCintergenicDe novo--Yuen2017 G
FOXN3     11938.p1chr14:
89951874-89951874
GGGTGTGTGAGAGTAGAGTAAATAATCAintronicMaternal--Wilfert2021 G
FOXN3     11341.p1chr14:
89880608-89880608
TAintronicDe novo--Turner2016 G
FOXN3     A15chr14:
89954769-89954769
CTintronicDe novo--Wu2018 G
FOXN3     AU021204chr14:
89860827-89860827
GAintronicDe novo--Yuen2017 G
FOXN3     AU3806304chr14:
90091727-90091727
GAintergenicDe novo--Yuen2017 G
FOXN3     74-0117chr14:
89853770-89853770
ACintronicDe novo--Michaelson2012 G
FOXN3     AU3051302chr14:
90010420-90010420
TAintronicDe novo--Yuen2017 G
FOXN3     AU4159301chr14:
89780181-89780181
AGintronicDe novo--Yuen2017 G
FOXN3     AU3051302chr14:
90010450-90010450
TGintronicDe novo--Yuen2017 G
FOXN3     7-0254-004chr14:
90013056-90013056
TAintronicDe novo--Yuen2017 G
FOXN3     1-0488-003chr14:
89694201-89694201
CTintronicDe novo--Yuen2017 G
FOXN3     3-0392-000chr14:
89942390-89942390
CTintronicDe novo--Yuen2016 G
FOXN3     AU3903301chr14:
89770388-89770388
TGintronicDe novo--Yuen2017 G
FOXN3     1-0559-004chr14:
90030358-90030358
TTAintronicDe novo--Yuen2017 G
FOXN3     1-0049-004chr14:
89726798-89726803
CTTCTTCintronicDe novo--Yuen2017 G
FOXN3     AU054303chr14:
89966217-89966217
TCintronicDe novo--Yuen2017 G
FOXN3     1-0973-003chr14:
89925336-89925336
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More