or
or
Exact

Results for "LINC00374"

Variant Events: 81

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LINC00374     1-0054-003chr13:
59171066-59171066
TCintergenicDe novo--Yuen2017 G
LINC00374     1-0554-003chr13:
59649086-59649086
CAintergenicDe novo--Yuen2017 G
LINC00374     AU072505chr13:
59413058-59413058
AGintergenicDe novo--Yuen2017 G
LINC00374     1-0446-003chr13:
58826559-58826559
GAintergenicDe novo--Yuen2017 G
LINC00374     2-1426-003chr13:
59075179-59075179
TCintergenicDe novo--Yuen2017 G
LINC00374     AU072005chr13:
59155335-59155335
TCintergenicDe novo--Yuen2017 G
LINC00374     1-0473-003chr13:
59068847-59068847
CAintergenicDe novo--Yuen2017 G
LINC00374     5-0148-003chr13:
58906942-58906942
TGintergenicDe novo--Yuen2017 G
LINC00374     AU3506303chr13:
59958331-59958331
CTintergenicDe novo--Yuen2017 G
LINC00374     2-1352-003chr13:
60138554-60138554
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC00374     AU3794302chr13:
59694885-59694897
AGCTCCAGTTGCTAGCTintergenicDe novo--Yuen2017 G
LINC00374     2-1120-003chr13:
59706507-59706507
TTAAintergenicDe novo--Yuen2017 G
LINC00374     2-1452-003chr13:
59234167-59234167
CTintergenicDe novo--Yuen2017 G
LINC00374     AU3398301chr13:
59508541-59508541
AGintergenicDe novo--Yuen2017 G
LINC00374     1-0296-004chr13:
58871733-58871733
GAintergenicDe novo--Yuen2017 G
LINC00374     1-0158-003chr13:
59715547-59715547
AGintergenicDe novo--Yuen2017 G
LINC00374     1-0353-003chr13:
59043050-59043050
AGintergenicDe novo--Yuen2017 G
LINC00374     5-0114-003chr13:
59183485-59183485
GAintergenicDe novo--Yuen2017 G
LINC00374     AU031403chr13:
58858644-58858644
AGintergenicDe novo--Yuen2017 G
LINC00374     7-0123-003chr13:
60173749-60173749
ATintergenicDe novo--Yuen2017 G
LINC00374     1-0445-003chr13:
59302453-59302453
GAintergenicDe novo--Yuen2017 G
LINC00374     AU3725302chr13:
59286530-59286530
GAintergenicDe novo--Yuen2017 G
LINC00374     2-0223-004chr13:
58986153-58986153
GAintergenicDe novo--Yuen2017 G
LINC00374     3-0392-000chr13:
60122967-60122967
GAintergenicDe novo--Yuen2016 G
LINC00374     1-0898-003chr13:
59532271-59532275
CGGGGCGGGGGintergenicDe novo--Yuen2017 G
LINC00374     7-0129-003chr13:
59280214-59280214
TCintergenicDe novo--Yuen2017 G
LINC00374     1-0443-003chr13:
59579397-59579397
GAintergenicDe novo--Yuen2016 G
LINC00374     2-1188-003chr13:
59253336-59253336
GAintergenicDe novo--Yuen2017 G
LINC00374     1-0403-004chr13:
59391589-59391589
CGintergenicDe novo--Yuen2017 G
LINC00374     1-0465-003achr13:
59232018-59232018
GCintergenicDe novo--Yuen2017 G
LINC00374     1-0352-005chr13:
59366876-59366886
AGTCTCATTTGAGTCTCATTTGTCTCATTTGintergenicDe novo--Yuen2017 G
LINC00374     1-0435-003chr13:
59663172-59663172
CTintergenicDe novo--Yuen2017 G
LINC00374     2-1384-003chr13:
60096142-60096142
GTintergenicDe novo--Yuen2017 G
LINC00374     2-1327-004chr13:
59879325-59879325
TCintergenicDe novo--Yuen2017 G
LINC00374     2-1366-004chr13:
60025309-60025309
AGintergenicDe novo--Yuen2017 G
LINC00374     AU3763305chr13:
59923210-59923210
AGintergenicDe novo--Yuen2017 G
LINC00374     7-0167-003chr13:
59788631-59788631
GCintergenicDe novo--Yuen2017 G
LINC00374     5-0025-003chr13:
59939055-59939055
TCintergenicDe novo--Yuen2017 G
LINC00374     3-0209-000chr13:
59547363-59547363
CTintergenicDe novo--Yuen2017 G
LINC00374     AU3397302chr13:
59078153-59078153
CTintergenicDe novo--Yuen2017 G
LINC00374     1-0092-003chr13:
59685451-59685451
AAAGintergenicDe novo--Yuen2017 G
LINC00374     AU034904chr13:
59196486-59196486
CGintergenicDe novo--Yuen2017 G
LINC00374     1-0936-003chr13:
58864923-58864923
AGintergenicDe novo--Yuen2017 G
LINC00374     1-0459-003chr13:
58986842-58986842
AGintergenicDe novo--Yuen2017 G
LINC00374     1-0278-003chr13:
59415234-59415234
GAintergenicDe novo--Yuen2016 G
LINC00374     7-0171-003chr13:
59681856-59681856
GCintergenicDe novo--Yuen2017 G
LINC00374     63-343chr13:
60108301-60108301
CAintergenicDe novo--Michaelson2012 G
LINC00374     AU3984302chr13:
59265651-59265651
CTintergenicDe novo--Yuen2017 G
LINC00374     2-0127-004chr13:
59220476-59220476
TCintergenicDe novo--Yuen2017 G
LINC00374     3-0431-000chr13:
58905122-58905122
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC00374     1-0465-003chr13:
59232018-59232018
GCintergenicDe novo--Yuen2017 G
LINC00374     AU3866301chr13:
59999350-59999350
GAintergenicDe novo--Yuen2017 G
LINC00374     1-0271-003chr13:
60156907-60156907
TGintergenicDe novo--Yuen2017 G
LINC00374     2-1505-004chr13:
59813876-59813876
GAintergenicDe novo--Yuen2017 G
LINC00374     1-0347-003chr13:
59742943-59742943
GTintergenicDe novo--Yuen2017 G
LINC00374     1-0494-003Achr13:
60080390-60080390
CTintergenicDe novo--Yuen2017 G
LINC00374     1-0497-003chr13:
59401542-59401542
CTintergenicDe novo--Yuen2017 G
LINC00374     AU003405chr13:
59374301-59374301
CTintergenicDe novo--Yuen2017 G
LINC00374     AU3786301chr13:
60212110-60212110
GAintergenicDe novo--Yuen2017 G
LINC00374     2-0022-005chr13:
60023009-60023009
ACintergenicDe novo--Yuen2017 G
LINC00374     AU3808304chr13:
59029123-59029123
ATintergenicDe novo--Yuen2017 G
LINC00374     AU3808304chr13:
59170739-59170739
GTintergenicDe novo--Yuen2017 G
LINC00374     7-0059-003chr13:
59689343-59689343
TTTGGTAAGGintergenicDe novo--Yuen2017 G
LINC00374     1-0382-003chr13:
59813406-59813406
GAintergenicDe novo--Yuen2017 G
LINC00374     AU4243302chr13:
59613990-59613990
TCintergenicDe novo--Yuen2017 G
LINC00374     11194.p1chr13:
58886699-58886699
CTintergenicDe novo--Turner2016 G
LINC00374     AU3635301chr13:
59649128-59649128
CGintergenicDe novo--Yuen2017 G
LINC00374     2-0143-004chr13:
59706507-59706507
TTAAintergenicDe novo--Yuen2017 G
LINC00374     11341.p1chr13:
59562702-59562702
TCintergenicDe novo--Turner2016 G
LINC00374     AU4269301chr13:
59236231-59236231
AGintergenicDe novo--Yuen2017 G
LINC00374     1-0627-003chr13:
59822184-59822184
GAintergenicDe novo--Yuen2017 G
LINC00374     2-0295-004chr13:
59530124-59530124
CTintergenicDe novo--Yuen2017 G
LINC00374     AU024004chr13:
60156321-60156325
AGTGTAGTintergenicDe novo--Yuen2017 G
LINC00374     2-1456-003chr13:
59687863-59687863
TCintergenicDe novo--Yuen2017 G
LINC00374     AU4435301chr13:
59027938-59027938
GAintergenicDe novo--Yuen2017 G
LINC00374     1-0509-003chr13:
59728093-59728093
ATintergenicDe novo--Yuen2017 G
LINC00374     1-0494-003chr13:
60080390-60080390
CTintergenicDe novo--Yuen2017 G
LINC00374     7-0219-003chr13:
59611207-59611207
CTintergenicDe novo--Yuen2017 G
LINC00374     2-1261-003chr13:
58857494-58857494
TAintergenicDe novo--Yuen2017 G
LINC00374     AU046904chr13:
59221638-59221638
AGintergenicDe novo--Yuen2017 G
LINC00374     AU3692301chr13:
58855540-58855540
AGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More