or
or
Exact

Results for "LINC01435"

Variant Events: 111

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LINC01435     AU4056302chr10:
110781115-110781115
AGintergenicDe novo--Yuen2017 G
LINC01435     A4chr10:
109713373-109713373
CAncRNA_intronicDe novo--Wu2018 G
LINC01435     74-0265chr10:
110060987-110060987
GAintergenicDe novo--Michaelson2012 G
LINC01435     74-0265chr10:
110568348-110568348
CTintergenicDe novo--Michaelson2012 G
LINC01435     1-0191-003chr10:
111465273-111465273
GAintergenicDe novo--Yuen2017 G
LINC01435     2-1127-003chr10:
110860946-110860946
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01435     AU3951302chr10:
111357818-111357827
TAAAGACAAATAAAintergenicDe novo--Yuen2017 G
LINC01435     1-0092-004chr10:
110740837-110740837
TCintergenicDe novo--Yuen2017 G
LINC01435     1-0253-004chr10:
110539097-110539097
CCTGintergenicDe novo--Yuen2017 G
LINC01435     AU031004chr10:
110042759-110042773
GGTGTGTGTGTGTGTGGTGTGTGTintergenicDe novo--Yuen2017 G
LINC01435     1-0441-003chr10:
111267055-111267055
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01435     AU3716301chr10:
110591627-110591627
GAintergenicDe novo--Yuen2017 G
LINC01435     AU4145301chr10:
111221296-111221296
GCintergenicDe novo--Yuen2017 G
LINC01435     AU4365302chr10:
110540887-110540888
TGTintergenicDe novo--Yuen2017 G
LINC01435     7-0223-003chr10:
111302497-111302497
GAintergenicDe novo--Yuen2017 G
LINC01435     AU028305chr10:
111105020-111105020
GAintergenicDe novo--Yuen2017 G
LINC01435     2-1526-003chr10:
111079664-111079664
GAintergenicDe novo--Yuen2017 G
LINC01435     2-1134-003chr10:
110194742-110194742
GAintergenicDe novo--Yuen2017 G
LINC01435     AU3343301chr10:
109876894-109876894
CAintergenicDe novo--Yuen2017 G
LINC01435     AU4024303chr10:
110688692-110688692
GAintergenicDe novo--Yuen2017 G
LINC01435     AU3397302chr10:
111227998-111228005
TTTTGTTTTTTTintergenicDe novo--Yuen2017 G
LINC01435     1-0107-003chr10:
110815507-110815507
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01435     1-0150-004chr10:
111597265-111597265
GCintergenicDe novo--Yuen2017 G
LINC01435     AU060004chr10:
109710366-109710366
GAncRNA_intronicDe novo--Yuen2017 G
LINC01435     AU4173301chr10:
111494037-111494037
CTintergenicDe novo--Yuen2017 G
LINC01435     1-0590-003chr10:
111222795-111222795
TGintergenicDe novo--Yuen2017 G
LINC01435     AU076508chr10:
110622929-110622929
CTintergenicDe novo--Yuen2017 G
LINC01435     2-1281-003chr10:
111143921-111143921
CTintergenicDe novo--Yuen2017 G
LINC01435     1-0336-003chr10:
111247247-111247247
CTintergenicDe novo--Yuen2017 G
LINC01435     2-1417-003chr10:
110145116-110145116
CTintergenicDe novo--Yuen2017 G
LINC01435     7-0254-003chr10:
109830995-109830995
AGintergenicDe novo--Yuen2017 G
LINC01435     7-0254-003chr10:
109884559-109884559
GAintergenicDe novo--Yuen2017 G
LINC01435     1-0862-003chr10:
110710036-110710036
CGintergenicDe novo--Yuen2017 G
LINC01435     1-0441-003chr10:
111267010-111267010
ATintergenicDe novo--Yuen2017 G
LINC01435     1-0665-003chr10:
110126083-110126083
TCintergenicDe novo--Yuen2017 G
LINC01435     AU062204chr10:
109816541-109816541
CAncRNA_intronicDe novo--Yuen2017 G
LINC01435     AU062204chr10:
109816553-109816553
TCncRNA_intronicDe novo--Yuen2017 G
LINC01435     2-1436-003chr10:
110154310-110154310
GCintergenicDe novo--Yuen2017 G
LINC01435     AU3866301chr10:
111046652-111046652
GAintergenicDe novo--Yuen2017 G
LINC01435     1-0354-006chr10:
109745046-109745046
AAAAAGncRNA_intronicDe novo--Yuen2017 G
LINC01435     1-0556-003chr10:
110684476-110684476
AGintergenicDe novo--Yuen2017 G
LINC01435     AU4308302chr10:
110077475-110077475
CTintergenicDe novo--Yuen2017 G
LINC01435     AU4231301chr10:
111623013-111623014
CACAAintergenicDe novo--Yuen2017 G
LINC01435     5-0041-003chr10:
110194628-110194628
CTintergenicDe novo--Yuen2017 G
LINC01435     AU1542301chr10:
110366282-110366282
TAintergenicDe novo--Yuen2017 G
LINC01435     1-0380-003chr10:
110710017-110710017
CAintergenicDe novo--Yuen2017 G
LINC01435     1-0560-003chr10:
109855661-109855661
CTintergenicDe novo--Yuen2017 G
LINC01435     AU074403chr10:
111359258-111359258
CTintergenicDe novo--Yuen2017 G
LINC01435     1-0285-003chr10:
110844745-110844745
AGintergenicDe novo--Yuen2017 G
LINC01435     AU3716302chr10:
111008028-111008028
GTintergenicDe novo--Yuen2017 G
LINC01435     2-1730-003chr10:
110609434-110609434
CTintergenicDe novo--Yuen2017 G
LINC01435     7-0106-003chr10:
110864078-110864078
CAintergenicDe novo--Yuen2017 G
LINC01435     AU011604chr10:
109990215-109990215
TCintergenicDe novo--Yuen2017 G
LINC01435     1-0458-005chr10:
110738915-110738915
TGintergenicDe novo--Yuen2017 G
LINC01435     1-0303-003chr10:
111031250-111031250
GCintergenicDe novo--Yuen2017 G
LINC01435     1-0526-003chr10:
111327536-111327536
CTintergenicDe novo--Yuen2017 G
LINC01435     AU3782303chr10:
109754363-109754363
TCncRNA_intronicDe novo--Yuen2017 G
LINC01435     AU3912302chr10:
111156577-111156577
AGintergenicDe novo--Yuen2017 G
LINC01435     2-1422-003chr10:
110044583-110044588
TTATATTTATATATintergenicDe novo--Yuen2017 G
LINC01435     AU006804chr10:
111479784-111479784
CAintergenicDe novo--Yuen2017 G
LINC01435     AU4176302chr10:
110166370-110166370
CTintergenicDe novo--Yuen2017 G
LINC01435     13486.p1chr10:
110513491-110513491
TCintergenicDe novo--Wilfert2021 G
LINC01435     2-1315-003chr10:
110439737-110439737
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01435     AU3052302chr10:
111468180-111468180
CAintergenicDe novo--Yuen2017 G
LINC01435     AU3052302chr10:
111468189-111468189
TAintergenicDe novo--Yuen2017 G
LINC01435     1-0218-004chr10:
110011653-110011653
AGintergenicDe novo--Yuen2017 G
LINC01435     AU2787301chr10:
110413856-110413856
CTintergenicDe novo--Yuen2017 G
LINC01435     1-0512-003chr10:
110424275-110424313
ATGTGTGTGTGTGTGTGTTTGTGTGTGTGTGTGTGTGTGATGTGTGTGTGTGTGTTTGTGTGTGTGTGTGTGTGTGintergenicDe novo--Yuen2017 G
LINC01435     7-0102-003chr10:
110756691-110756691
GAintergenicDe novo--Yuen2017 G
LINC01435     1-0153-004chr10:
110195874-110195877
AGCTAintergenicDe novo--Yuen2017 G
LINC01435     AU070703chr10:
110030366-110030366
AGintergenicDe novo--Yuen2017 G
LINC01435     1-0668-003chr10:
111186180-111186180
AGintergenicDe novo--Yuen2017 G
LINC01435     1-0373-003chr10:
111027134-111027134
CTintergenicDe novo--Yuen2017 G
LINC01435     2-1268-003chr10:
110329313-110329313
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01435     1-0139-005chr10:
110525383-110525383
CAintergenicDe novo--Yuen2017 G
LINC01435     AU4099301chr10:
111413116-111413116
TCintergenicDe novo--Yuen2017 G
LINC01435     2-1268-003chr10:
111285216-111285216
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01435     2-1362-004chr10:
110976783-110976785
CATCintergenicDe novo--Yuen2017 G
LINC01435     1-0452-003chr10:
110058069-110058069
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01435     7-0249-003chr10:
110548544-110548544
ACintergenicDe novo--Yuen2017 G
LINC01435     2-1241-003chr10:
110473952-110473952
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01435     AU063004chr10:
110156590-110156590
CAintergenicDe novo--Yuen2017 G
LINC01435     2-1375-003chr10:
110892320-110892320
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01435     5-0117-003chr10:
111521321-111521321
GAintergenicDe novo--Yuen2017 G
LINC01435     2-1280-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
LINC01435     AU002405chr10:
111122909-111122909
CGintergenicDe novo--Yuen2017 G
LINC01435     AU4032307chr10:
110001446-110001446
TCintergenicDe novo--Yuen2017 G
LINC01435     7-0119-003chr10:
111250420-111250420
CTintergenicDe novo--Yuen2017 G
LINC01435     1-0638-003chr10:
110457153-110457153
ACintergenicDe novo--Yuen2017 G
LINC01435     2-1341-004chr10:
111477916-111477916
TCintergenicDe novo--Yuen2017 G
LINC01435     AU1308303chr10:
111143424-111143424
GAintergenicDe novo--Yuen2017 G
LINC01435     12529.p1chr10:
110428523-110428523
TCintergenicDe novo--Turner2016 G
LINC01435     11252.p1chr10:
111020032-111020032
AGintergenicDe novo--Turner2016 G
LINC01435     1-0585-003chr10:
111160611-111160611
TCintergenicDe novo--Yuen2017 G
LINC01435     2-0272-004chr10:
110740245-110740247
TCATintergenicDe novo--Yuen2017 G
LINC01435     1-0490-003chr10:
110426016-110426016
CTintergenicDe novo--Yuen2017 G
LINC01435     AU3911302chr10:
111120488-111120488
CAintergenicDe novo--Yuen2017 G
LINC01435     AU3911302chr10:
111125697-111125697
AGintergenicDe novo--Yuen2017 G
LINC01435     1-0381-003chr10:
109669237-109669237
GTncRNA_intronicDe novo--Yuen2017 G
LINC01435     7-0251-003chr10:
110070011-110070011
GTintergenicDe novo--Yuen2017 G
LINC01435     AU075803chr10:
109726909-109726909
CTncRNA_intronicDe novo--Yuen2017 G
LINC01435     2-1437-004chr10:
109658098-109658098
TCncRNA_intronicDe novo--Yuen2017 G
LINC01435     AU071203chr10:
111565954-111565954
GCintergenicDe novo--Yuen2017 G
LINC01435     2-0210-004chr10:
109780868-109780868
GAncRNA_intronicDe novo--Yuen2017 G
LINC01435     A4chr10:
111123722-111123722
AGintergenicDe novo--Wu2018 G
LINC01435     2-0304-003chr10:
110472515-110472515
ATintergenicDe novo--Yuen2017 G
LINC01435     7-0253-005chr10:
109830732-109830732
TCintergenicDe novo--Yuen2017 G
LINC01435     AU015903chr10:
110295555-110295555
GAintergenicDe novo--Yuen2017 G
LINC01435     2-1169-004chr10:
110699220-110699220
TCintergenicDe novo--Yuen2017 G
LINC01435     5-0137-003chr10:
110468561-110468561
CTintergenicDe novo--Yuen2017 G
LINC01435     AU1725306chr10:
111560730-111560730
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More