or
or
Exact

Results for "LOC102724957"

Variant Events: 17

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LOC102724957   1-0978-003chr11:
15955301-15955301
AGintergenicDe novo--Yuen2017 G
LOC102724957   5-0110-003chr11:
15809068-15809068
CAintergenicDe novo--Yuen2017 G
LOC102724957   1-0559-004chr11:
15895329-15895329
CAintergenicDe novo--Yuen2017 G
LOC102724957   1-0986-003chr11:
15881090-15881090
CGintergenicDe novo--Yuen2017 G
LOC102724957   AU030703chr11:
15759969-15759969
GAintergenicDe novo--Yuen2017 G
LOC102724957   2-1511-003chr11:
15929178-15929194
CCACACACACACACACACCACACACACACACAintergenicDe novo--Yuen2017 G
LOC102724957   AU1521301chr11:
15928331-15928331
GTintergenicDe novo--Yuen2017 G
LOC102724957   1-0150-003chr11:
15827039-15827039
CTintergenicDe novo--Yuen2017 G
LOC102724957   63-343chr11:
15793508-15793508
GAintergenicDe novo--Michaelson2012 G
LOC102724957   AU3779304chr11:
15846171-15846171
TCintergenicDe novo--Yuen2017 G
LOC102724957   AU053503chr11:
15955280-15955280
CTintergenicDe novo--Yuen2017 G
LOC102724957   AU3190305chr11:
15759132-15759132
CAintergenicDe novo--Yuen2017 G
LOC102724957   2-1382-003chr11:
15926919-15926919
GTintergenicDe novo--Yuen2017 G
LOC102724957   1-0387-003chr11:
15790814-15790814
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC102724957   1-0912-003chr11:
15801359-15801359
CTintergenicDe novo--Yuen2017 G
LOC102724957   AU005213chr11:
15813555-15813555
TAintergenicDe novo--Yuen2017 G
LOC102724957   7-0130-003chr11:
15948209-15948209
GGTCTCTCTGGAGACAGAGTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More