or
or
Exact

Results for "DISC1FP1"

Variant Events: 94

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DISC1FP1     1-0595-004chr11:
90962106-90962106
AACintergenicDe novo--Yuen2017 G
DISC1FP1     2-0022-004chr11:
90809864-90809864
AGintergenicDe novo--Yuen2017 G
DISC1FP1     2-1245-003chr11:
91338917-91338917
TCintergenicDe novo--Yuen2017 G
DISC1FP1     1-0520-003chr11:
90984779-90984779
TCintergenicDe novo--Yuen2017 G
DISC1FP1     2-1382-003chr11:
90303126-90303126
ACncRNA_intronicDe novo--Yuen2016 G
Yuen2017 G
DISC1FP1     2-0242-003chr11:
90732721-90732721
AGintergenicDe novo--Yuen2017 G
DISC1FP1     2-1085-003chr11:
91072847-91072847
CGintergenicDe novo--Yuen2017 G
DISC1FP1     AU4485302chr11:
91291783-91291783
AGintergenicDe novo--Yuen2017 G
DISC1FP1     AU060403chr11:
90895428-90895428
CTintergenicDe novo--Yuen2017 G
DISC1FP1     1-0604-003chr11:
91031037-91031037
GCintergenicDe novo--Yuen2017 G
DISC1FP1     AU4347301chr11:
91395560-91395560
TCintergenicDe novo--Yuen2017 G
DISC1FP1     1-1004-003chr11:
90389130-90389130
TCncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     5-0055-004chr11:
90195305-90195305
ATncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     AU072504chr11:
91629733-91629733
CTintergenicDe novo--Yuen2017 G
DISC1FP1     2-1169-003chr11:
90359759-90359759
CAncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     AU061104chr11:
90708078-90708078
ATintergenicDe novo--Yuen2017 G
DISC1FP1     2-1196-003chr11:
90885146-90885146
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
DISC1FP1     7-0068-003chr11:
90561568-90561568
TCncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     2-1336-003chr11:
90281132-90281132
CTncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     1-0092-004chr11:
90695435-90695435
CAintergenicDe novo--Yuen2017 G
DISC1FP1     2-1646-003chr11:
91218354-91218354
CTintergenicDe novo--Yuen2017 G
DISC1FP1     1-0524-003chr11:
90647006-90647006
CGncRNA_intronicDe novo--Yuen2016 G
Yuen2017 G
DISC1FP1     1-0906-003chr11:
90713093-90713093
TCintergenicDe novo--Yuen2017 G
DISC1FP1     2-0110-003chr11:
90487836-90487836
CAncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     1-0485-003chr11:
90823109-90823109
GAintergenicDe novo--Yuen2017 G
DISC1FP1     AU4433301chr11:
91759589-91759589
GAintergenicDe novo--Yuen2017 G
DISC1FP1     1-0485-003chr11:
90803919-90803919
GAintergenicDe novo--Yuen2017 G
DISC1FP1     1-0552-003chr11:
91853836-91853836
ACintergenicDe novo--Yuen2017 G
DISC1FP1     1-0593-003chr11:
90787041-90787041
ACintergenicDe novo--Yuen2017 G
DISC1FP1     AU3648301chr11:
90514976-90514976
AGncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     7-0183-003chr11:
90958171-90958171
CTintergenicDe novo--Yuen2017 G
DISC1FP1     1-0978-003chr11:
90894072-90894072
CTintergenicDe novo--Yuen2017 G
DISC1FP1     2-0116-005chr11:
91814443-91814443
AAGTAACAGATintergenicDe novo--Yuen2017 G
DISC1FP1     A14chr11:
90004443-90004443
GAncRNA_intronicDe novo--Wu2018 G
DISC1FP1     74-0355chr11:
91695897-91695897
TCintergenicDe novo--Michaelson2012 G
DISC1FP1     AU4283301chr11:
90421637-90421637
ACncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     1-0522-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
DISC1FP1     AU038703chr11:
90818338-90818338
TTCGAGintergenicDe novo--Yuen2017 G
DISC1FP1     2-1362-004chr11:
91941885-91941885
CAintergenicDe novo--Yuen2017 G
DISC1FP1     2-1235-003chr11:
91440337-91440337
CGintergenicDe novo--Yuen2017 G
DISC1FP1     2-0273-003chr11:
90066175-90066175
TCncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     AU3997301chr11:
90225044-90225044
GCncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     AU4089302chr11:
90628961-90628961
GTncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     AU4099301chr11:
91103060-91103060
TCintergenicDe novo--Yuen2017 G
DISC1FP1     1-0804-003chr11:
90257292-90257292
TCncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     7-0100-004chr11:
90195305-90195305
ATncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     2-1277-003chr11:
90580444-90580444
GAncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     AU3636301chr11:
91968969-91968969
AGintergenicDe novo--Yuen2017 G
DISC1FP1     AU3724302chr11:
91327524-91327528
TAAAATAAAintergenicDe novo--Yuen2017 G
DISC1FP1     AU3853302chr11:
91317061-91317061
TCintergenicDe novo--Yuen2017 G
DISC1FP1     AU4033305chr11:
91584335-91584335
ATintergenicDe novo--Yuen2017 G
DISC1FP1     AU1987302chr11:
92024007-92024007
GAintergenicDe novo--Yuen2017 G
DISC1FP1     2-1166-003chr11:
90519932-90519932
TGncRNA_intronicDe novo--Yuen2016 G
Yuen2017 G
DISC1FP1     AU071804chr11:
90075384-90075384
TCncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     1-0320-004chr11:
91562589-91562589
AGintergenicDe novo--Yuen2017 G
DISC1FP1     1-0400-003chr11:
90710742-90710742
AGintergenicDe novo--Yuen2017 G
DISC1FP1     1-0300-003chr11:
90151496-90151496
GAncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     AU065304chr11:
91809379-91809379
CGintergenicDe novo--Yuen2017 G
DISC1FP1     1-0261-004chr11:
90195320-90195320
ATncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     2-1195-003chr11:
91257322-91257322
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
DISC1FP1     AU065304chr11:
91897180-91897180
AGintergenicDe novo--Yuen2017 G
DISC1FP1     1-0539-003chr11:
90195305-90195305
ATncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     7-0119-003chr11:
92022371-92022371
AGintergenicDe novo--Yuen2017 G
DISC1FP1     5-0030-003chr11:
90739127-90739127
TAintergenicDe novo--Yuen2017 G
DISC1FP1     AU4487302chr11:
91160503-91160503
GAintergenicDe novo--Yuen2017 G
DISC1FP1     AU059903chr11:
90514046-90514046
AGncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     1-0638-003chr11:
91562425-91562425
TCintergenicDe novo--Yuen2017 G
DISC1FP1     AU024104chr11:
91308081-91308081
GAintergenicDe novo--Yuen2017 G
DISC1FP1     AU1909304chr11:
91974207-91974207
GAintergenicDe novo--Yuen2017 G
DISC1FP1     1-0595-005chr11:
91247906-91247906
GAintergenicDe novo--Yuen2017 G
DISC1FP1     2-0116-004chr11:
91814443-91814443
AAGTAACAGATintergenicDe novo--Yuen2017 G
DISC1FP1     2-1164-003chr11:
90935644-90935644
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
DISC1FP1     AU4070301chr11:
91204796-91204796
TCintergenicDe novo--Yuen2017 G
DISC1FP1     AU4093304chr11:
91251020-91251020
CTintergenicDe novo--Yuen2017 G
DISC1FP1     2-1140-003chr11:
90810915-90810915
TGintergenicDe novo--Yuen2017 G
DISC1FP1     AU2000305chr11:
91889678-91889678
TCintergenicDe novo--Yuen2017 G
DISC1FP1     2-0149-004chr11:
90519537-90519542
TAAAACTncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     3-0448-000chr11:
91932838-91932864
ATGTGTGTGTGTGTGCGTGTGTGTGTGATGTGTGTGTGTGCGTGTGTGTGTGintergenicDe novo--Yuen2017 G
DISC1FP1     2-1383-003chr11:
91618939-91618945
CAAAAAACAAAAAAAintergenicDe novo--Yuen2017 G
DISC1FP1     AU4007302chr11:
90122527-90122527
CTncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     1-0558-003chr11:
90622065-90622065
ATncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     AU3190305chr11:
90092068-90092068
GAncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     AU050910chr11:
90664501-90664501
GAintergenicDe novo--Yuen2017 G
DISC1FP1     1-0206-004chr11:
91591061-91591061
CTintergenicDe novo--Yuen2017 G
DISC1FP1     5-0129-003chr11:
90693654-90693654
TCintergenicDe novo--Yuen2017 G
DISC1FP1     2-1297-004chr11:
90562435-90562435
GAncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     2-1409-003chr11:
91865509-91865509
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
DISC1FP1     1-0582-003chr11:
90654667-90654667
GTintergenicDe novo--Yuen2017 G
DISC1FP1     1-0885-003chr11:
91535456-91535456
AGintergenicDe novo--Yuen2017 G
DISC1FP1     2-0304-003chr11:
90467168-90467168
GAncRNA_intronicDe novo--Yuen2017 G
DISC1FP1     1-0554-003chr11:
90695107-90695107
TGintergenicDe novo--Yuen2017 G
DISC1FP1     2-1730-003chr11:
92071924-92071924
GAintergenicDe novo--Yuen2017 G
DISC1FP1     2-1341-003chr11:
91748986-91748986
ACintergenicDe novo--Yuen2017 G
DISC1FP1     1-0541-004chr11:
90761452-90761452
TTGCATATTCTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More