or
or
Exact

Results for "PWRN3"

Variant Events: 9

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PWRN3     74-0688chr15:
24730801-24730801
CAintergenicDe novo--Michaelson2012 G
PWRN3     AU1933301chr15:
24730276-24730276
ATintergenicDe novo--Yuen2017 G
PWRN3     2-0002-005chr15:
24800522-24800522
CTintergenicDe novo--Yuen2017 G
PWRN3     AU1995302chr15:
24732381-24732381
TGintergenicDe novo--Yuen2017 G
PWRN3     AU3724301chr15:
24701983-24702002
TTAGGAAAACCTTTGTCAATTTintergenicDe novo--Yuen2017 G
PWRN3     AU3703302chr15:
24722442-24722442
GCintergenicDe novo--Yuen2017 G
PWRN3     AU3610302chr15:
24767237-24767237
ACintergenicDe novo--Yuen2017 G
PWRN3     AU4173301chr15:
24726764-24726764
GAintergenicDe novo--Yuen2017 G
PWRN3     2-1725-003chr15:
24784600-24784600
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More