or
or
Exact

Results for "LOC101928535"

Variant Events: 38

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LOC101928535    1-0346-004chr11:
106187967-106187967
AGintergenicDe novo--Yuen2017 G
LOC101928535    1-0495-003chr11:
106207531-106207531
AGintergenicDe novo--Yuen2017 G
LOC101928535    1-0175-004chr11:
106465660-106465660
CTintergenicDe novo--Yuen2017 G
LOC101928535    5-0138-003chr11:
106521169-106521169
CTintergenicDe novo--Yuen2017 G
LOC101928535    2-1549-003chr11:
106432811-106432825
CCTCTCTCTCTCTCTCCTCTCTCTCTCTintergenicDe novo--Yuen2017 G
LOC101928535    A30chr11:
106337024-106337024
TGintergenicDe novo--Wu2018 G
LOC101928535    1-0112-004chr11:
106348577-106348577
CTintergenicDe novo--Yuen2017 G
LOC101928535    2-0127-004chr11:
106169732-106169732
TCintergenicDe novo--Yuen2017 G
LOC101928535    1-0469-005chr11:
106488849-106488849
TCintergenicDe novo--Yuen2017 G
LOC101928535    2-0142-003chr11:
106538662-106538662
TCintergenicDe novo--Yuen2017 G
LOC101928535    3-0438-000chr11:
106513623-106513623
GTintergenicDe novo--Yuen2016 G
LOC101928535    2-0063-003chr11:
106138785-106138785
GGGACATGAintergenicDe novo--Yuen2017 G
LOC101928535    1-0092-004chr11:
106411789-106411789
TCintergenicDe novo--Yuen2017 G
LOC101928535    1-0497-003chr11:
106390633-106390633
CTintergenicDe novo--Yuen2017 G
LOC101928535    AU3849303chr11:
106455736-106455736
TCintergenicDe novo--Yuen2017 G
LOC101928535    2-1421-003chr11:
106289949-106289949
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC101928535    AU024608chr11:
106386606-106386606
GTintergenicDe novo--Yuen2017 G
LOC101928535    AU007503chr11:
106240320-106240320
CGintergenicDe novo--Yuen2017 G
LOC101928535    AU4159301chr11:
106210990-106210990
CTintergenicDe novo--Yuen2017 G
LOC101928535    74-0075chr11:
106240320-106240320
CGintergenicDe novo--Michaelson2012 G
LOC101928535    A2chr11:
106366582-106366582
GCintergenicDe novo--Wu2018 G
LOC101928535    2-1107-003chr11:
106529822-106529822
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC101928535    1-0142-005chr11:
106234877-106234880
GAATGintergenicDe novo--Yuen2017 G
LOC101928535    2-1176-003chr11:
106270175-106270175
GAintergenicDe novo--Yuen2017 G
LOC101928535    A2chr11:
106364364-106364364
CAintergenicDe novo--Wu2018 G
LOC101928535    2-1591-003chr11:
106479054-106479054
CGintergenicDe novo--Yuen2017 G
LOC101928535    1-0139-005chr11:
106531281-106531281
CGintergenicDe novo--Yuen2017 G
LOC101928535    1-0482-003chr11:
106181678-106181678
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC101928535    1-0368-004chr11:
106138785-106138785
GGGACATGAintergenicDe novo--Yuen2017 G
LOC101928535    1-0627-004chr11:
106211193-106211193
GAintergenicDe novo--Yuen2017 G
LOC101928535    2-1339-003chr11:
106352622-106352622
GTintergenicDe novo--Yuen2017 G
LOC101928535    2-1579-003chr11:
106332878-106332878
CTintergenicDe novo--Yuen2017 G
LOC101928535    13023.p1chr11:
106412432-106412432
CTintergenicDe novo--Turner2016 G
LOC101928535    14153.p1chr11:
106376353-106376353
TCintergenicDe novo--Turner2016 G
LOC101928535    AU073003chr11:
106313402-106313427
TTGCCCCAGAGAATGCCCCAGAGAATTTGCCCCAGAGAATintergenicDe novo--Yuen2017 G
LOC101928535    AU078503chr11:
106412026-106412026
TCintergenicDe novo--Yuen2017 G
LOC101928535    1-0323-004chr11:
106420991-106420991
GAintergenicDe novo--Yuen2017 G
LOC101928535    2-1341-003chr11:
106294900-106294900
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More