or
or
Exact

Results for "LOC101927967"

Variant Events: 69

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LOC101927967   1-0756-004chr2:
78982906-78982906
TCintergenicDe novo--Yuen2017 G
LOC101927967   AU4186302chr2:
78150543-78150543
GAncRNA_intronicDe novo--Yuen2017 G
LOC101927967   AU4215302chr2:
78262478-78262478
CTncRNA_intronicDe novo--Yuen2017 G
LOC101927967   1-0590-003chr2:
79098612-79098616
ATGATAintergenicDe novo--Yuen2017 G
LOC101927967   1-0382-004chr2:
78033037-78033037
TTCncRNA_intronicDe novo--Yuen2017 G
LOC101927967   1-0539-003chr2:
78946427-78946427
GAintergenicDe novo--Yuen2017 G
LOC101927967   AU4237302chr2:
78465208-78465208
GTncRNA_intronicDe novo--Yuen2017 G
LOC101927967   11219.p1chr2:
79164893-79164893
GTintergenicDe novo--Werling2018 G
LOC101927967   AU2139305chr2:
78266943-78266943
GAncRNA_intronicDe novo--Yuen2017 G
LOC101927967   1-0173-004chr2:
78090595-78090595
AGncRNA_intronicDe novo--Yuen2017 G
LOC101927967   AU1988301chr2:
79070174-79070174
CAintergenicDe novo--Yuen2017 G
LOC101927967   AU4429301chr2:
79222864-79222864
CTintergenicDe novo--Yuen2017 G
LOC101927967   1-0551-003chr2:
78221088-78221088
TCncRNA_intronicDe novo--Yuen2017 G
LOC101927967   AU1687302chr2:
78257912-78257912
ATncRNA_intronicDe novo--Yuen2017 G
LOC101927967   1-0299-004chr2:
78036036-78036036
AGncRNA_intronicDe novo--Yuen2017 G
LOC101927967   1-0497-003chr2:
78009122-78009122
CTncRNA_intronicDe novo--Yuen2017 G
LOC101927967   AU2495302chr2:
78715986-78715986
GCintergenicDe novo--Yuen2017 G
LOC101927967   AU2495302chr2:
78717384-78717384
TGintergenicDe novo--Yuen2017 G
LOC101927967   1-0004-003chr2:
78753268-78753268
TGintergenicDe novo--Yuen2017 G
LOC101927967   1-0547-003chr2:
78071040-78071040
GAncRNA_intronicDe novo--Yuen2017 G
LOC101927967   1-0044-003chr2:
79053491-79053491
CTintergenicDe novo--Yuen2017 G
LOC101927967   1-0701-003chr2:
78235857-78235862
CTATATCTATncRNA_intronicDe novo--Yuen2017 G
LOC101927967   2-0019-004chr2:
78641894-78641894
AGintergenicDe novo--Yuen2017 G
LOC101927967   AU2000305chr2:
78653575-78653575
AGintergenicDe novo--Yuen2017 G
LOC101927967   AU3912303chr2:
78107804-78107804
GCncRNA_intronicDe novo--Yuen2017 G
LOC101927967   1-0289-003chr2:
79129477-79129477
CTintergenicDe novo--Yuen2017 G
LOC101927967   1-0338-005chr2:
78805474-78805474
GAintergenicDe novo--Yuen2017 G
LOC101927967   1-0197-004chr2:
78899427-78899427
GAintergenicDe novo--Yuen2017 G
LOC101927967   2-0063-003chr2:
78088786-78088786
GTncRNA_intronicDe novo--Yuen2017 G
LOC101927967   2-0109-003chr2:
79161501-79161512
GTACTAGTCCAAGintergenicDe novo--Yuen2017 G
LOC101927967   AU4183301chr2:
78457363-78457363
CTncRNA_intronicDe novo--Yuen2017 G
LOC101927967   1-0304-003chr2:
78286147-78286147
GAncRNA_intronicDe novo--Yuen2016 G
Yuen2017 G
LOC101927967   AU2951302chr2:
79160838-79160838
CTintergenicDe novo--Yuen2017 G
LOC101927967   2-1323-003chr2:
78901758-78901758
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC101927967   AU2139303chr2:
78116145-78116146
GAGncRNA_intronicDe novo--Yuen2017 G
LOC101927967   AU2951303chr2:
79160838-79160838
CTintergenicDe novo--Yuen2017 G
LOC101927967   AU4284301chr2:
78671665-78671665
GTintergenicDe novo--Yuen2017 G
LOC101927967   2-1407-003chr2:
78821376-78821376
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC101927967   AU4308302chr2:
78139087-78139087
GCncRNA_intronicDe novo--Yuen2017 G
LOC101927967   1-0756-005chr2:
78036036-78036036
AGncRNA_intronicDe novo--Yuen2017 G
LOC101927967   7-0194-003chr2:
77997307-77997307
ATncRNA_intronicDe novo--Yuen2017 G
LOC101927967   1-0292-005chr2:
78100154-78100154
TCncRNA_intronicDe novo--Yuen2017 G
LOC101927967   1-0826-004chr2:
78167325-78167325
GAncRNA_intronicDe novo--Yuen2017 G
LOC101927967   2-1261-003chr2:
78935870-78935870
GAintergenicDe novo--Yuen2017 G
LOC101927967   2-1169-003chr2:
78358982-78358982
GTncRNA_intronicDe novo--Yuen2017 G
LOC101927967   AU3768302chr2:
78615003-78615003
GAintergenicDe novo--Yuen2017 G
LOC101927967   AU2022302chr2:
78295105-78295105
CGncRNA_intronicDe novo--Yuen2017 G
LOC101927967   1-0197-003chr2:
78899427-78899427
GAintergenicDe novo--Yuen2017 G
LOC101927967   AU1687303chr2:
78257912-78257912
ATncRNA_intronicDe novo--Yuen2017 G
LOC101927967   2-1693-003chr2:
78209384-78209384
CAncRNA_intronicDe novo--Yuen2017 G
LOC101927967   1-0065-004chr2:
78036036-78036036
AGncRNA_intronicDe novo--Yuen2017 G
LOC101927967   63-343chr2:
78074545-78074545
AGncRNA_intronicDe novo--Michaelson2012 G
LOC101927967   2-1174-006chr2:
78570875-78570875
TCintergenicDe novo--Yuen2017 G
LOC101927967   AU3885305chr2:
79049054-79049054
TCintergenicDe novo--Yuen2017 G
LOC101927967   AU3885305chr2:
79101033-79101033
GAintergenicDe novo--Yuen2017 G
LOC101927967   2-1275-003chr2:
78142435-78142435
ACncRNA_intronicDe novo--Yuen2017 G
LOC101927967   5-0055-003chr2:
78364408-78364408
GCncRNA_intronicDe novo--Yuen2017 G
LOC101927967   7-0102-003chr2:
78827138-78827138
TCintergenicDe novo--Yuen2017 G
LOC101927967   AU4145301chr2:
79034703-79034703
CGintergenicDe novo--Yuen2017 G
LOC101927967   AU3885304chr2:
78956250-78956250
CTintergenicDe novo--Yuen2017 G
LOC101927967   1-0925-003chr2:
78735510-78735510
TCintergenicDe novo--Yuen2017 G
LOC101927967   1-0591-003chr2:
78640577-78640582
ATTTTTATTTintergenicDe novo--Yuen2017 G
LOC101927967   2-1425-004chr2:
79241272-79241272
GCintergenicDe novo--Yuen2017 G
LOC101927967   5-0017-004chr2:
78655765-78655765
GTintergenicDe novo--Yuen2017 G
LOC101927967   AU076509chr2:
79249630-79249630
ATintergenicDe novo--Yuen2017 G
LOC101927967   2-1300-003chr2:
78041303-78041303
CGncRNA_intronicDe novo--Yuen2017 G
LOC101927967   3-0482-000chr2:
78101108-78101109
ACAncRNA_intronicDe novo--Yuen2017 G
LOC101927967   AU056005chr2:
79069437-79069437
AGintergenicDe novo--Yuen2017 G
LOC101927967   1-0520-003chr2:
78744049-78744063
GTATATATATATATAGTATATATATATAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More