or
or
Exact

Results for "MIR5694"

Variant Events: 53

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MIR5694     1-0175-004chr10:
122399591-122399591
ATncRNA_intronicDe novo--Yuen2017 G
MIR5694     1-0991-003chr10:
123190332-123190332
TCintergenicDe novo--Yuen2017 G
MIR5694     2-1426-003chr10:
122518282-122518282
TGncRNA_intronicDe novo--Yuen2017 G
MIR5694     2-1426-003chr10:
122515814-122515814
CGncRNA_intronicDe novo--Yuen2017 G
MIR5694     AU3874302chr10:
122405825-122405825
GAncRNA_intronicDe novo--Yuen2017 G
MIR5694     74-0355chr10:
122636302-122636302
AGncRNA_intronicDe novo--Michaelson2012 G
MIR5694     5-0077-004chr10:
122460696-122460696
AAAGTGCTGCTCCCncRNA_intronicDe novo--Yuen2017 G
MIR5694     AU4462302chr10:
123070025-123070025
GAintergenicDe novo--Yuen2017 G
MIR5694     5-0077-004chr10:
122717116-122717116
CCTATAncRNA_intronicDe novo--Yuen2017 G
MIR5694     AU4032305chr10:
122743987-122743987
CTncRNA_intronicDe novo--Yuen2017 G
MIR5694     13918.p1chr10:
123129571-123129571
ATintergenicDe novo--Werling2018 G
MIR5694     2-1428-003chr10:
122434166-122434166
CTncRNA_intronicDe novo--Yuen2017 G
MIR5694     2-1251-003chr10:
122859599-122859599
CTintergenicDe novo--Yuen2017 G
MIR5694     1-0206-003chr10:
122460696-122460696
AAAGTGCTGCTCCCncRNA_intronicDe novo--Yuen2017 G
MIR5694     1-0389-004chr10:
123082731-123082731
AGintergenicDe novo--Yuen2017 G
MIR5694     2-0202-003chr10:
122472234-122472234
CTncRNA_intronicDe novo--Yuen2017 G
MIR5694     1-0564-003chr10:
122416802-122416802
TCncRNA_intronicDe novo--Yuen2017 G
MIR5694     1-0373-003chr10:
123133254-123133254
TTCACTGGintergenicDe novo--Yuen2017 G
MIR5694     2-1290-003chr10:
122703734-122703746
TGGCGCCGTGCACTncRNA_intronicDe novo--Yuen2017 G
MIR5694     7-0135-003chr10:
122442263-122442263
TCncRNA_intronicDe novo--Yuen2017 G
MIR5694     AU4412302chr10:
123218380-123218380
CTintergenicDe novo--Yuen2017 G
MIR5694     1-0406-003chr10:
122951850-122951852
ACTAintergenicDe novo--Yuen2017 G
MIR5694     AU066403chr10:
122982306-122982306
CAintergenicDe novo--Yuen2017 G
MIR5694     AU066403chr10:
122982336-122982336
TCintergenicDe novo--Yuen2017 G
MIR5694     2-1619-003chr10:
122752130-122752130
CAncRNA_intronicDe novo--Yuen2017 G
MIR5694     1-0150-004chr10:
122701429-122701429
CAncRNA_intronicDe novo--Yuen2017 G
MIR5694     5-0064-003chr10:
122453630-122453630
TGncRNA_intronicDe novo--Yuen2017 G
MIR5694     1-0995-003chr10:
122991128-122991143
TGAGAGAGAGAGAGAGTGAGAGAGAGAGAGintergenicDe novo--Yuen2017 G
MIR5694     1-0215-006chr10:
123057737-123057737
CTintergenicDe novo--Yuen2017 G
MIR5694     1-0402-003chr10:
122470517-122470519
ACCAncRNA_intronicDe novo--Yuen2017 G
MIR5694     1-0214-003chr10:
123173115-123173115
ACintergenicDe novo--Yuen2017 G
MIR5694     2-1353-003chr10:
122759399-122759399
CTncRNA_intronicDe novo--Yuen2016 G
Yuen2017 G
MIR5694     1-0439-003chr10:
122920967-122920967
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
MIR5694     2-1429-003chr10:
123082381-123082381
ATintergenicDe novo--Yuen2017 G
MIR5694     5-0131-003chr10:
122909447-122909447
TCintergenicDe novo--Yuen2017 G
MIR5694     13934.p1chr10:
122626297-122626298
ATAncRNA_intronicDe novo--Satterstrom2020 E
MIR5694     2-0310-003chr10:
123119452-123119456
AGCCCAintergenicDe novo--Yuen2017 G
MIR5694     1-0044-003chr10:
123104452-123104452
GAintergenicDe novo--Yuen2017 G
MIR5694     2-1508-004chr10:
122629881-122629881
GAncRNA_intronicDe novo--Yuen2017 G
MIR5694     AU3779301chr10:
122385360-122385360
CTncRNA_intronicDe novo--Yuen2017 G
MIR5694     13946.p1chr10:
122401338-122401338
CGncRNA_intronicDe novo--Turner2016 G
MIR5694     1-0403-003chr10:
122399970-122399970
GTncRNA_intronicDe novo--Yuen2017 G
MIR5694     11341.p1chr10:
122634030-122634030
TCncRNA_intronicDe novo--Turner2016 G
MIR5694     1-0099-003chr10:
123021429-123021429
AGintergenicDe novo--Yuen2017 G
MIR5694     13298.p1chr10:
122931780-122931780
ACintergenicDe novo--Turner2016 G
MIR5694     1-0161-004chr10:
122491988-122491988
AGncRNA_intronicDe novo--Yuen2017 G
MIR5694     05C49685chr10:
122660633-122660633
GCncRNA_intronicDe novo--Satterstrom2020 E
MIR5694     2-1368-003chr10:
122487965-122487965
GTncRNA_intronicDe novo--Yuen2017 G
MIR5694     1-0569-003chr10:
122355845-122355845
ACncRNA_intronicDe novo--Yuen2017 G
MIR5694     1-0569-003chr10:
122369695-122369695
AGncRNA_intronicDe novo--Yuen2017 G
MIR5694     1-0972-003chr10:
122662209-122662209
GAncRNA_intronicDe novo--Yuen2017 G
MIR5694     AU3263302chr10:
123150790-123150790
TCintergenicDe novo--Yuen2017 G
MIR5694     AU3811301chr10:
122525338-122525338
CTncRNA_intronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More