or
or
Exact

Results for "MIR4426"

Variant Events: 45

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MIR4426     2-1425-004chr16:
61371628-61371628
GTintergenicDe novo--Yuen2017 G
MIR4426     14370.p1chr16:
61356346-61356346
CTintergenicDe novo--Turner2016 G
MIR4426     2-1389-003chr16:
61139071-61139071
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
MIR4426     3-0209-000chr16:
61104316-61104316
GTintergenicDe novo--Yuen2017 G
MIR4426     12449.p1chr16:
61579641-61579641
TAintergenicDe novo--Turner2016 G
MIR4426     2-0296-003chr16:
61296246-61296246
TCintergenicDe novo--Yuen2017 G
MIR4426     AU3955303chr16:
61379092-61379097
CAAAAACAAAAAAintergenicDe novo--Yuen2017 G
MIR4426     2-1357-004chr16:
61205179-61205179
GAintergenicDe novo--Yuen2017 G
MIR4426     74-0117chr16:
61632763-61632763
CTintergenicDe novo--Michaelson2012 G
MIR4426     2-1250-003chr1:
192721135-192721135
TAintergenicDe novo--Yuen2017 G
MIR4426     2-0033-003chr16:
61265785-61265786
AGAintergenicDe novo--Yuen2016 G
Yuen2017 G
MIR4426     AU4452302chr16:
61463059-61463059
GAintergenicDe novo--Yuen2017 G
MIR4426     2-1117-003chr16:
61121786-61121786
CTintergenicDe novo--Yuen2016 G
MIR4426     1-0186-004chr16:
61394076-61394076
AGintergenicDe novo--Yuen2017 G
MIR4426     2-1114-003chr16:
61641498-61641498
GAintergenicDe novo--Yuen2017 G
MIR4426     5-0095-003chr1:
192725461-192725461
GAintergenicDe novo--Yuen2017 G
MIR4426     5-0021-003chr1:
192708266-192708266
ATintergenicDe novo--Yuen2017 G
MIR4426     AU2381302chr16:
61509589-61509589
GGATCintergenicDe novo--Yuen2017 G
MIR4426     2-0285-003chr16:
61163925-61163925
GTintergenicDe novo--Yuen2017 G
MIR4426     2-1290-004chr16:
61245938-61245938
TCintergenicDe novo--Yuen2017 G
MIR4426     AU3900301chr16:
61202738-61202738
GTintergenicDe novo--Yuen2017 G
MIR4426     2-1514-003chr16:
61322109-61322109
GAintergenicDe novo--Yuen2017 G
MIR4426     1-0509-003chr16:
61204952-61204952
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
MIR4426     AU061104chr16:
61532256-61532266
GCACACACACAGCACACACAintergenicDe novo--Yuen2017 G
MIR4426     5-0128-003chr16:
61594488-61594488
GAintergenicDe novo--Yuen2017 G
MIR4426     7-0128-003chr16:
61493912-61493917
TCCAAATintergenicDe novo--Yuen2017 G
MIR4426     1-0141-003chr16:
61214538-61214538
AGintergenicDe novo--Yuen2017 G
MIR4426     1-0755-003chr16:
61507460-61507460
TCintergenicDe novo--Yuen2017 G
MIR4426     1-0487-003chr16:
61368012-61368012
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
MIR4426     AU011704chr16:
61632763-61632763
CTintergenicDe novo--Yuen2017 G
MIR4426     2-0297-004chr16:
61296935-61296942
CTCTGTCTCTCTintergenicDe novo--Yuen2017 G
MIR4426     5-0003-004chr16:
61232322-61232322
TCintergenicDe novo--Yuen2017 G
MIR4426     AU4433301chr16:
61541713-61541713
TCintergenicDe novo--Yuen2017 G
MIR4426     AU3371302chr16:
61206245-61206245
ACintergenicDe novo--Yuen2017 G
MIR4426     AU3398301chr16:
61425703-61425703
CAintergenicDe novo--Yuen2017 G
MIR4426     3-0428-000chr16:
61354013-61354013
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
MIR4426     1-0403-003chr16:
61335406-61335406
CTintergenicDe novo--Yuen2017 G
MIR4426     1-0701-003chr1:
192774618-192774618
ATintergenicDe novo--Yuen2017 G
MIR4426     1-0032-003chr16:
61353666-61353666
GAintergenicDe novo--Yuen2017 G
MIR4426     5-0026-003chr16:
61678203-61678203
CTintergenicDe novo--Yuen2017 G
MIR4426     7-0055-003chr16:
61459705-61459705
TCintergenicDe novo--Yuen2017 G
MIR4426     11002.p1chr16:
61158791-61158791
CTintergenicDe novo--Turner2016 G
MIR4426     7-0175-003chr16:
61313740-61313740
CAintergenicDe novo--Yuen2017 G
MIR4426     AU2975301chr16:
61585603-61585603
GAintergenicDe novo--Yuen2017 G
MIR4426     2-1522-003chr16:
61435905-61435905
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More