or
or
Exact

Results for "MIR4527"

Variant Events: 27

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MIR4527     1-0006-003chr18:
45011241-45011244
AATGAintergenicDe novo--Yuen2017 G
MIR4527     1-0006-004chr18:
45011241-45011244
AATGAintergenicDe novo--Yuen2017 G
MIR4527     AU045514chr18:
45321907-45321907
GCintergenicDe novo--Yuen2017 G
MIR4527     13298.p1chr18:
45015775-45015775
CTintergenicDe novo--Turner2016 G
MIR4527     14642.p1chr18:
45184964-45184964
GAintergenicDe novo--Turner2016 G
MIR4527     AU1687302chr18:
44926597-44926597
GAintergenicDe novo--Yuen2017 G
MIR4527     2-1356-003chr18:
45210372-45210372
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
MIR4527     AU4129303chr18:
44988123-44988123
TAintergenicDe novo--Yuen2017 G
MIR4527     1-0373-003chr18:
44967473-44967473
GAintergenicDe novo--Yuen2017 G
MIR4527     1-0554-003chr18:
45352817-45352817
GAintergenicDe novo--Yuen2017 G
MIR4527     2-1417-003chr18:
45127022-45127022
AAATintergenicDe novo--Yuen2017 G
MIR4527     AU055004chr18:
45263310-45263310
GAintergenicDe novo--Yuen2017 G
MIR4527     2-0242-003chr18:
44920815-44920815
TCintergenicDe novo--Yuen2017 G
MIR4527     1-0186-004chr18:
45267041-45267041
GTintergenicDe novo--Yuen2017 G
MIR4527     7-0080-003chr18:
45237517-45237518
GCGintergenicDe novo--Yuen2017 G
MIR4527     AU1687303chr18:
44926597-44926597
GAintergenicDe novo--Yuen2017 G
MIR4527     1-0526-003chr18:
45126966-45126966
CCCATGACCACCACCATCATCATintergenicDe novo--Yuen2017 G
MIR4527     AU2000302chr18:
45237600-45237600
CGintergenicDe novo--Yuen2017 G
MIR4527     AU3839302chr18:
45245598-45245598
GAintergenicDe novo--Yuen2017 G
MIR4527     2-1702-003chr18:
44979150-44979150
CTintergenicDe novo--Yuen2017 G
MIR4527     1-0323-003chr18:
45126926-45126926
AATintergenicDe novo--Yuen2017 G
MIR4527     A10chr18:
45124493-45124493
CGintergenicDe novo--Wu2018 G
MIR4527     1-0651-003chr18:
45270992-45270992
CAintergenicDe novo--Yuen2017 G
MIR4527     2-1264-003chr18:
45159260-45159260
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
MIR4527     63-449chr18:
45088529-45088529
CTintergenicDe novo--Michaelson2012 G
MIR4527     1-0651-003chr18:
45274565-45274565
CAintergenicDe novo--Yuen2017 G
MIR4527     AU3808304chr18:
45138617-45138617
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More