or
or
Exact

Results for "MIR4686"

Variant Events: 12

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MIR4686     5-0131-003chr11:
2259364-2259364
CCTGCTAintergenicDe novo--Yuen2017 G
MIR4686     1-0278-003chr11:
2243143-2243143
ATintergenicDe novo--Yuen2016 G
MIR4686     1-0252-003chr11:
2241087-2241087
CTintergenicDe novo--Yuen2017 G
MIR4686     2-1292-004chr11:
2250646-2250646
GAintergenicDe novo--Yuen2017 G
MIR4686     AU1987301chr11:
2276552-2276552
AGintergenicDe novo--Yuen2017 G
MIR4686     2-0238-004chr11:
2234687-2234687
AGintergenicDe novo--Yuen2017 G
MIR4686     1-0481-003chr11:
2258964-2258964
CTintergenicDe novo--Yuen2017 G
MIR4686     1-0113-003chr11:
2281113-2281113
CTintergenicDe novo--Yuen2016 G
MIR4686     2-0297-003chr11:
2238005-2238012
CACAGCCACACAGCCAAACAGCCAintergenicDe novo--Yuen2017 G
MIR4686     2-1338-003chr11:
2208036-2208036
AGintergenicDe novo--Yuen2017 G
MIR4686     63-343chr11:
2208095-2208095
CTintergenicInherited--Michaelson2012 G
MIR4686     AU3451301chr11:
2225954-2225954
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More