or
or
Exact

Results for "CDH8"

Variant Events: 133

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CDH8     5-0103-003chr16:
62943843-62943853
ATTTCTTTCTTATTTCTTintergenicDe novo--Yuen2017 G
CDH8     2-1184-003chr16:
62467538-62467538
ATintergenicDe novo--Yuen2017 G
CDH8     2-1629-003chr16:
63510503-63510503
AGintergenicDe novo--Yuen2017 G
CDH8     11239.p1chr16:
62686535-62686535
CTintergenicDe novo--Wilfert2021 G
CDH8     2-1379-003chr16:
63594534-63594535
CTCintergenicDe novo--Yuen2017 G
CDH8     1-0632-003chr16:
62215221-62215221
TCintergenicDe novo--Yuen2017 G
CDH8     A26chr16:
63376129-63376129
AGintergenicDe novo--Wu2018 G
CDH8     1-0303-004chr16:
63431980-63431980
AGintergenicDe novo--Yuen2017 G
CDH8     1-0674-003chr16:
62315488-62315488
GAintergenicDe novo--Yuen2017 G
CDH8     1-0104-004chr16:
63331659-63331659
GAintergenicDe novo--Yuen2017 G
CDH8     AU1635302chr16:
61965213-61965213
GAintronicDe novo--Yuen2017 G
CDH8     2-1355-004chr16:
61786598-61786598
TCintronicDe novo--Yuen2017 G
CDH8     AU3900301chr16:
63068639-63068639
GTintergenicDe novo--Yuen2017 G
CDH8     7-0174-003chr16:
61896491-61896491
GCintronicDe novo--Yuen2017 G
CDH8     1-0408-003chr16:
63978607-63978607
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
CDH8     AU1860301chr16:
63332706-63332706
TCintergenicDe novo--Yuen2017 G
CDH8     2-0297-004chr16:
64036922-64036922
ATintergenicDe novo--Yuen2017 G
CDH8     AU1933302chr16:
62533367-62533367
CTintergenicDe novo--Yuen2017 G
CDH8     PN400248chr16:
61687916-61687916
GAexonicUnknownnonsynonymous SNVNM_001796c.C1996Tp.R666C28.00.0019Leblond2019 E
CDH8     PN400474chr16:
61687916-61687916
GAexonicUnknownnonsynonymous SNVNM_001796c.C1996Tp.R666C28.00.0019Leblond2019 E
CDH8     1-0998-003chr16:
62311087-62311104
TTCTCTCTCTCTCTCTCTTTCTCTCTCTCTCTCTintergenicDe novo--Yuen2017 G
CDH8     7-0095-004chr16:
63561195-63561195
CCAGATintergenicDe novo--Yuen2017 G
CDH8     5-0017-004chr16:
62540861-62540861
AGintergenicDe novo--Yuen2017 G
CDH8     AU072004chr16:
62719035-62719035
GAintergenicDe novo--Yuen2017 G
CDH8     1-0640-003chr16:
63627221-63627221
GAintergenicDe novo--Yuen2017 G
CDH8     AU3397302chr16:
63383758-63383758
AGintergenicDe novo--Yuen2017 G
CDH8     AU4024303chr16:
62565797-62565797
AGintergenicDe novo--Yuen2017 G
CDH8     2-1342-003chr16:
62577403-62577403
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
CDH8     AU3052301chr16:
63924547-63924547
TCintergenicDe novo--Yuen2017 G
CDH8     AU4024303chr16:
63852743-63852743
TAintergenicDe novo--Yuen2017 G
CDH8     2-1185-003chr16:
61930754-61930754
TCintronicDe novo--Yuen2017 G
CDH8     AU054304chr16:
63936000-63936000
TAintergenicDe novo--Yuen2017 G
CDH8     1-0914-003chr16:
62426277-62426277
CTintergenicDe novo--Yuen2017 G
CDH8     2-1690-003chr16:
63177491-63177507
CGTGTGTGTGTGTGTGTCGTGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
CDH8     7-0167-003chr16:
62225655-62225655
CAintergenicDe novo--Yuen2017 G
CDH8     3-0140-000chr16:
62474488-62474488
CGintergenicDe novo--Yuen2017 G
CDH8     2-1281-003chr16:
62199698-62199698
AGintergenicDe novo--Yuen2017 G
CDH8     2-1626-003chr16:
62408976-62408976
AGintergenicDe novo--Yuen2017 G
CDH8     1-0559-003chr16:
62646077-62646077
CAintergenicDe novo--Yuen2017 G
CDH8     AU049304chr16:
62221371-62221371
GAintergenicDe novo--Yuen2017 G
CDH8     AU2569303chr16:
62029657-62029657
GAintronicDe novo--Yuen2017 G
CDH8     PN400286chr16:
61687916-61687916
GAexonicUnknownnonsynonymous SNVNM_001796c.C1996Tp.R666C28.00.0019Leblond2019 E
CDH8     AU039305chr16:
63185717-63185717
TCintergenicDe novo--Yuen2017 G
CDH8     5-0050-004chr16:
63850984-63850990
ATATATTAintergenicDe novo--Yuen2017 G
CDH8     3-0442-000chr16:
62038683-62038683
AGintronicDe novo--Yuen2016 G
Yuen2017 G
CDH8     1-0075-003chr16:
63172678-63172693
CAGAGAGAGAGAGAGACAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
CDH8     AU2863303chr16:
63657176-63657176
AGintergenicDe novo--Yuen2017 G
CDH8     1-0534-006chr16:
62786479-62786479
TCintergenicDe novo--Yuen2017 G
CDH8     AU1909304chr16:
61722376-61722376
ATintronicDe novo--Yuen2017 G
CDH8     1-0683-003chr16:
62985109-62985109
CTintergenicDe novo--Yuen2017 G
CDH8     2-1381-003chr16:
63854191-63854191
ATintergenicDe novo--Yuen2017 G
CDH8     AU3918301chr16:
63048854-63048854
CTintergenicDe novo--Yuen2017 G
CDH8     AU4243302chr16:
62525158-62525165
TAAAAAAATAAAAAAintergenicDe novo--Yuen2017 G
CDH8     AU3779301chr16:
63473033-63473033
TAintergenicDe novo--Yuen2017 G
CDH8     7-0055-003chr16:
63154569-63154569
CTintergenicDe novo--Yuen2017 G
CDH8     AU3645301chr16:
63720724-63720724
GAintergenicDe novo--Yuen2017 G
CDH8     PN400280chr16:
61687916-61687916
GAexonicUnknownnonsynonymous SNVNM_001796c.C1996Tp.R666C28.00.0019Leblond2019 E
CDH8     AU076705chr16:
63655383-63655383
AGintergenicDe novo--Yuen2017 G
CDH8     AU4269301chr16:
62932773-62932773
TCintergenicDe novo--Yuen2017 G
CDH8     1-0715-003chr16:
63629201-63629201
GCintergenicDe novo--Yuen2017 G
CDH8     2-1397-003chr16:
63682133-63682133
AGintergenicDe novo--Yuen2017 G
CDH8     AU056804chr16:
63295168-63295170
TAATintergenicDe novo--Yuen2017 G
CDH8     AU4260303chr16:
63506320-63506320
CTintergenicDe novo--Yuen2017 G
CDH8     74-0075chr16:
63592659-63592659
TCintergenicDe novo--Michaelson2012 G
CDH8     AU3703302chr16:
63823267-63823267
GAintergenicDe novo--Yuen2017 G
CDH8     AU3703302chr16:
63823277-63823277
GTintergenicDe novo--Yuen2017 G
CDH8     AU4152303chr16:
63909964-63909964
GCintergenicDe novo--Yuen2017 G
CDH8     2-0070-003chr16:
62801532-62801532
CGintergenicDe novo--Yuen2017 G
CDH8     AU050704chr16:
62409121-62409121
TGintergenicDe novo--Yuen2017 G
CDH8     2-1196-003chr16:
62771039-62771039
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
CDH8     1-0224-004chr16:
63786883-63786883
CTintergenicDe novo--Yuen2017 G
CDH8     AU3906301chr16:
63062729-63062748
TTGTGTGTGTGTGTGTGTGTTTGTGTGTGTGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
CDH8     1-0906-003chr16:
62265270-62265278
GATAATAATGATAATintergenicDe novo--Yuen2017 G
CDH8     2-0272-003chr16:
62138155-62138155
GAintergenicDe novo--Yuen2017 G
CDH8     1-0051-004chr16:
63754916-63754916
TGintergenicDe novo--Yuen2017 G
CDH8     AU060403chr16:
62699977-62699977
CTintergenicDe novo--Yuen2017 G
CDH8     PN400491chr16:
61687916-61687916
GAexonicUnknownnonsynonymous SNVNM_001796c.C1996Tp.R666C28.00.0019Leblond2019 E
CDH8     1-0906-003chr16:
63863412-63863412
GAintergenicDe novo--Yuen2017 G
CDH8     AU050403chr16:
63318536-63318536
AGintergenicDe novo--Yuen2017 G
CDH8     AU2333302chr16:
63801988-63801988
GAintergenicDe novo--Yuen2017 G
CDH8     1-0514-003chr16:
63419779-63419779
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
CDH8     AU2793301chr16:
62889224-62889224
GAintergenicDe novo--Yuen2017 G
CDH8     3-0392-000chr16:
61932982-61932982
AGintronicDe novo--Yuen2016 G
CDH8     1-0625-003chr16:
63161696-63161699
ACCCAintergenicDe novo--Yuen2017 G
CDH8     2-0116-005chr16:
63142955-63142955
TCintergenicDe novo--Yuen2017 G
CDH8     1-0344-003chr16:
62865285-62865285
AGintergenicDe novo--Yuen2017 G
CDH8     PN400505chr16:
61687916-61687916
GAexonicUnknownnonsynonymous SNVNM_001796c.C1996Tp.R666C28.00.0019Leblond2019 E
CDH8     PN400483chr16:
61687916-61687916
GAexonicUnknownnonsynonymous SNVNM_001796c.C1996Tp.R666C28.00.0019Leblond2019 E
CDH8     AU2793301chr16:
62889218-62889218
CTintergenicDe novo--Yuen2017 G
CDH8     AU009903chr16:
63345918-63345918
CTintergenicDe novo--Yuen2017 G
CDH8     2-1228-003chr16:
64087621-64087621
ACintergenicDe novo--Yuen2017 G
CDH8     AU038703chr16:
62711867-62711870
CTTTCTTintergenicDe novo--Yuen2017 G
CDH8     PN400457chr16:
61687916-61687916
GAexonicUnknownnonsynonymous SNVNM_001796c.C1996Tp.R666C28.00.0019Leblond2019 E
CDH8     2-1093-005chr16:
63238172-63238172
TCintergenicDe novo--Yuen2017 G
CDH8     2-0088-003chr16:
62332568-62332568
GCintergenicDe novo--Yuen2017 G
CDH8     1-0572-003chr16:
63909209-63909209
ACintergenicDe novo--Yuen2017 G
CDH8     5-0033-004chr16:
62942433-62942436
GTTCGintergenicDe novo--Yuen2017 G
CDH8     AU2525302chr16:
63656385-63656385
CTintergenicDe novo--Yuen2017 G
CDH8     PN400186chr16:
61687916-61687916
GAexonicUnknownnonsynonymous SNVNM_001796c.C1996Tp.R666C28.00.0019Leblond2019 E
CDH8     2-1173-003chr16:
63139308-63139308
TCintergenicDe novo--Yuen2017 G
CDH8     2-1719-003chr16:
64048615-64048615
GAintergenicDe novo--Yuen2017 G
CDH8     1-0273-004chr16:
64008329-64008329
TCintergenicDe novo--Yuen2017 G
CDH8     1-0382-004chr16:
61830921-61830921
TCintronicDe novo--Yuen2017 G
CDH8     5-0054-003chr16:
63000957-63000957
ACintergenicDe novo--Yuen2017 G
CDH8     PN400240chr16:
61687916-61687916
GAexonicUnknownnonsynonymous SNVNM_001796c.C1996Tp.R666C28.00.0019Leblond2019 E
CDH8     1-0244-003chr16:
63857684-63857684
TGintergenicDe novo--Yuen2016 G
Yuen2017 G
CDH8     AU1933301chr16:
63121992-63121992
TCintergenicDe novo--Yuen2017 G
CDH8     A31chr16:
63274972-63274976
AAGAGAintergenicDe novo--Wu2018 G
CDH8     2-1117-003chr16:
63256298-63256298
ACintergenicDe novo--Yuen2017 G
CDH8     1-0745-003chr16:
61851298-61851298
CAintronicDe novo--Yuen2017 G
CDH8     A25chr16:
62230716-62230716
TCintergenicDe novo--Wu2018 G
CDH8     5-0133-003chr16:
62442236-62442236
TAintergenicDe novo--Yuen2017 G
CDH8     2-0145-004chr16:
62482536-62482536
GAintergenicDe novo--Yuen2017 G
CDH8     5-0050-003chr16:
63850984-63850990
ATATATTAintergenicDe novo--Yuen2017 G
CDH8     PN400267chr16:
61687916-61687916
GAexonicUnknownnonsynonymous SNVNM_001796c.C1996Tp.R666C28.00.0019Leblond2019 E
CDH8     AU3610302chr16:
62596417-62596417
ATintergenicDe novo--Yuen2017 G
CDH8     PN400396chr16:
61687916-61687916
GAexonicUnknownnonsynonymous SNVNM_001796c.C1996Tp.R666C28.00.0019Leblond2019 E
CDH8     1-0300-003chr16:
62591835-62591835
GCintergenicDe novo--Yuen2017 G
CDH8     AU4444304chr16:
62587129-62587129
GTintergenicDe novo--Yuen2017 G
CDH8     1-0595-005chr16:
63851996-63851996
GAintergenicDe novo--Yuen2017 G
CDH8     AU4263304chr16:
62094232-62094232
GTintergenicDe novo--Yuen2017 G
CDH8     2-0214-004chr16:
62914899-62914899
GCintergenicDe novo--Yuen2017 G
CDH8     2-1689-003chr16:
62936105-62936105
TAintergenicDe novo--Yuen2017 G
CDH8     AU1952305chr16:
63802086-63802086
CGintergenicDe novo--Yuen2017 G
CDH8     2-1164-003chr16:
63723793-63723793
ATintergenicDe novo--Yuen2017 G
CDH8     5-0061-003chr16:
62445953-62445953
TCintergenicDe novo--Yuen2017 G
CDH8     2-0305-004chr16:
61984120-61984120
CAintronicDe novo--Yuen2017 G
CDH8     AU3903301chr16:
63710559-63710559
CTintergenicDe novo--Yuen2017 G
CDH8     2-0295-004chr16:
64050798-64050798
CAintergenicDe novo--Yuen2017 G
CDH8     5-0071-003chr16:
63735317-63735317
CTintergenicDe novo--Yuen2017 G
CDH8     2-1369-003chr16:
62139135-62139135
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
CDH8     2-1579-003chr16:
63272001-63272001
GAintergenicDe novo--Yuen2017 G
CDH8     AU4479301chr16:
63601472-63601472
TCintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More