or
or
Exact

Results for "LINC00648"

Variant Events: 79

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LINC00648     1-0158-012chr14:
49142285-49142285
TCintergenicDe novo--Yuen2017 G
LINC00648     1-0559-005chr14:
48485957-48485960
GTGTGintergenicDe novo--Yuen2017 G
LINC00648     3-0216-000chr14:
48869502-48869502
TGintergenicDe novo--Yuen2017 G
LINC00648     2-1341-003chr14:
49146080-49146080
CTintergenicDe novo--Yuen2017 G
LINC00648     2-1308-003chr14:
48289362-48289362
TGintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC00648     1-0232-004chr14:
48972825-48972825
GAintergenicDe novo--Yuen2017 G
LINC00648     2-1497-003chr14:
49210650-49210650
TGintergenicDe novo--Yuen2017 G
LINC00648     2-0022-004chr14:
49622190-49622190
GAintergenicDe novo--Yuen2017 G
LINC00648     1-0046-003chr14:
49299817-49299817
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC00648     7-0250-003chr14:
49691167-49691167
GAintergenicDe novo--Yuen2017 G
LINC00648     AU4242302chr14:
49820467-49820467
ACintergenicDe novo--Yuen2017 G
LINC00648     1-0028-003chr14:
48929178-48929178
GCintergenicDe novo--Yuen2017 G
LINC00648     1-0473-003chr14:
48498078-48498078
GTintergenicDe novo--Yuen2017 G
LINC00648     AU3900301chr14:
48476878-48476878
CGintergenicDe novo--Yuen2017 G
LINC00648     5-0025-004chr14:
49773864-49773864
CTintergenicDe novo--Yuen2017 G
LINC00648     2-1279-003chr14:
49859112-49859112
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC00648     1-0395-004chr14:
48518673-48518676
AAATAintergenicDe novo--Yuen2017 G
LINC00648     AU3399303chr14:
48439029-48439029
AGintergenicDe novo--Yuen2017 G
LINC00648     AU3857301chr14:
49155855-49155855
ATintergenicDe novo--Yuen2017 G
LINC00648     AU4092302chr14:
49616861-49616861
TCintergenicDe novo--Yuen2017 G
LINC00648     AU3638302chr14:
49298207-49298207
GAintergenicDe novo--Yuen2017 G
LINC00648     1-0454-003chr14:
49796053-49796053
TCintergenicDe novo--Yuen2017 G
LINC00648     2-1510-003chr14:
48634467-48634486
CTATTATTATTATTATTATTCTATTATTATTATTATTintergenicDe novo--Yuen2017 G
LINC00648     5-0084-003chr14:
49403485-49403485
CCCTCTTCAAAintergenicDe novo--Yuen2017 G
LINC00648     AU047704chr14:
49741437-49741437
GAintergenicDe novo--Yuen2017 G
LINC00648     1-0246-004chr14:
48689211-48689211
ACintergenicDe novo--Yuen2017 G
LINC00648     2-1485-004chr14:
48956011-48956011
GTintergenicDe novo--Yuen2017 G
LINC00648     1-0395-003chr14:
48518673-48518676
AAATAintergenicDe novo--Yuen2017 G
LINC00648     1-0231-004chr14:
48681658-48681658
GAintergenicDe novo--Yuen2017 G
LINC00648     AU4429301chr14:
49077968-49077968
CTintergenicDe novo--Yuen2017 G
LINC00648     2-1306-004chr14:
49854056-49854056
CTintergenicDe novo--Yuen2017 G
LINC00648     2-1296-003chr14:
49404574-49404574
GAintergenicDe novo--Yuen2017 G
LINC00648     2-1363-003chr14:
49259262-49259262
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC00648     2-0713-003chr14:
48617982-48617982
AGintergenicDe novo--Yuen2017 G
LINC00648     AU1355301chr14:
48365890-48365890
CTintergenicDe novo--Yuen2017 G
LINC00648     AU3881302chr14:
49259524-49259524
CTintergenicDe novo--Yuen2017 G
LINC00648     1-0357-003chr14:
48619214-48619214
GAintergenicDe novo--Yuen2017 G
LINC00648     AU2792302chr14:
49169604-49169604
AGintergenicDe novo--Yuen2017 G
LINC00648     2-1460-003chr14:
48607574-48607574
AGintergenicDe novo--Yuen2017 G
LINC00648     A27chr14:
49123907-49123907
GTintergenicDe novo--Wu2018 G
LINC00648     2-1129-003chr14:
48752715-48752715
ATintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC00648     1-0520-003chr14:
48430528-48430528
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC00648     1-0433-004chr14:
48651623-48651623
TTAGCintergenicDe novo--Yuen2017 G
LINC00648     1-0200-004chr14:
48408421-48408421
GAintergenicDe novo--Yuen2017 G
LINC00648     2-1461-003chr14:
48886708-48886708
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC00648     AU1952305chr14:
49261269-49261269
ACintergenicDe novo--Yuen2017 G
LINC00648     11729.p1chr14:
49558842-49558842
GCintergenicDe novo--Wilfert2021 G
LINC00648     1-0206-005chr14:
48690392-48690392
TCintergenicDe novo--Yuen2017 G
LINC00648     11194.p1chr14:
48401451-48401451
TCintergenicDe novo--Turner2016 G
LINC00648     2-1456-004chr14:
49045524-49045527
ATCTAintergenicDe novo--Yuen2017 G
LINC00648     1-0494-003Achr14:
49138145-49138147
CATCintergenicDe novo--Yuen2017 G
LINC00648     AU3984302chr14:
49302079-49302079
TGintergenicDe novo--Yuen2017 G
LINC00648     7-0133-003chr14:
48964149-48964149
TTGintergenicDe novo--Yuen2017 G
LINC00648     60-2027chr14:
49229747-49229747
AGintergenicDe novo--Michaelson2012 G
LINC00648     12449.p1chr14:
49824631-49824631
GAintergenicDe novo--Turner2016 G
LINC00648     AU066206chr14:
48435632-48435632
TCintergenicDe novo--Yuen2017 G
LINC00648     AU066206chr14:
48436411-48436411
TCintergenicDe novo--Yuen2017 G
LINC00648     13393.p1chr14:
48691898-48691898
TGintergenicDe novo--Turner2016 G
LINC00648     1-0912-003chr14:
48366643-48366643
ATintergenicDe novo--Yuen2017 G
LINC00648     13023.p1chr14:
49302616-49302616
GAintergenicDe novo--Turner2016 G
LINC00648     2-0019-004chr14:
49669064-49669064
AGintergenicDe novo--Yuen2017 G
LINC00648     2-1485-003chr14:
48956011-48956011
GTintergenicDe novo--Yuen2017 G
LINC00648     1-0382-003chr14:
49701712-49701712
TCintergenicDe novo--Yuen2017 G
LINC00648     1-0269-005chr14:
49746481-49746481
GAintergenicDe novo--Yuen2017 G
LINC00648     AU1860302chr14:
49946900-49946900
GAintergenicDe novo--Yuen2017 G
LINC00648     2-1350-004chr14:
48686387-48686387
GCintergenicDe novo--Yuen2017 G
LINC00648     AU3874303chr14:
49096874-49096874
TCintergenicDe novo--Yuen2017 G
LINC00648     2-1567-003chr14:
48299723-48299723
GAintergenicDe novo--Yuen2017 G
LINC00648     AU0780302chr14:
49152020-49152034
TCAAACAAACAAACATCAAACAAACAintergenicDe novo--Yuen2017 G
LINC00648     1-0494-003chr14:
49138145-49138147
CATCintergenicDe novo--Yuen2017 G
LINC00648     2-1632-003chr14:
48899978-48899978
GAintergenicDe novo--Yuen2017 G
LINC00648     1-0674-004chr14:
48290332-48290332
AGintergenicDe novo--Yuen2017 G
LINC00648     2-0171-003chr14:
48345533-48345533
CTintergenicDe novo--Yuen2017 G
LINC00648     2-0126-004chr14:
49920705-49920705
GAintergenicDe novo--Yuen2017 G
LINC00648     AU0780302chr14:
49250662-49250662
AGintergenicDe novo--Yuen2017 G
LINC00648     5-0015-004chr14:
48312586-48312586
GAintergenicDe novo--Yuen2017 G
LINC00648     AU1987304chr14:
49140957-49140957
GAintergenicDe novo--Yuen2017 G
LINC00648     1-0674-004chr14:
48935500-48935500
AGintergenicDe novo--Yuen2017 G
LINC00648     2-1715-003chr14:
49707760-49707763
GTGAGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More