
Results for "CTTNBP2"

Variant Events: 123

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
CTTNBP2     M32001chr7:
TCTCATexonicDe novoframeshift deletionNM_033427c.3473_3476delp.V1158fs--Guo2018 T
CTTNBP2     mAGRE2644chr7:
TCsplicingPaternalsplicing13.02-Cirnigliaro2023 G
CTTNBP2     mAGRE2643chr7:
TCsplicingPaternalsplicing13.02-Cirnigliaro2023 G
CTTNBP2     mAGRE1048chr7:
CAGCexonicMaternalframeshift deletionNM_033427c.4498_4499delp.L1500fs--Cirnigliaro2023 G
CTTNBP2     2-1511-003chr7:
CTTNBP2     Stessman2017:ASD-1627chr7:
TGsplicingInheritedsplicing21.7-Stessman2017 T
CTTNBP2     M16163chr7:
GAexonicMaternalnonsynonymous SNVNM_033427c.C3890Tp.A1297V0.112.496E-5Guo2018 T
CTTNBP2     M18461chr7:
TAexonicMaternalnonsynonymous SNVNM_033427c.A2517Tp.K839N14.49-Guo2018 T
CTTNBP2     M19799chr7:
GAexonicMaternalnonsynonymous SNVNM_033427c.C3001Tp.R1001C23.57.415E-5Guo2018 T
CTTNBP2     PN400367chr7:
TTAAATCATCCCTGGAATCAGexonicUnknownstopgainNM_033427c.4667_4668insCTGATTCCAGGGATGATTTp.L1556_R1557delinsFX--Leblond2019 E
CTTNBP2     AU3053301chr7:
GAintronicDe novo--Trost2022 G
Yuen2017 G
CTTNBP2     M12513chr7:
TCexonicMaternalnonsynonymous SNVNM_033427c.A215Gp.Q72R26.98.265E-6Guo2018 T
CTTNBP2     M08428chr7:
TAexonicMaternalnonsynonymous SNVNM_033427c.A1096Tp.I366F5.7411.647E-5Guo2018 T
CTTNBP2     11030.p1chr7:
GAGintergenicDe novo--Werling2018 G
CTTNBP2     M12382chr7:
GAexonicMaternalnonsynonymous SNVNM_033427c.C1757Tp.S586L13.328.239E-6Guo2018 T
CTTNBP2     M15081chr7:
GAexonicMaternalnonsynonymous SNVNM_033427c.C2437Tp.P813S21.88.254E-6Guo2018 T
CTTNBP2     M31980chr7:
CAACexonicDe novoframeshift deletionNM_033427c.2651_2652delp.F884fs--Guo2018 T
CTTNBP2     M15212chr7:
GAexonicMaternalnonsynonymous SNVNM_033427c.C1519Tp.P507S8.114-Guo2018 T
CTTNBP2     M27823chr7:
CTexonicMaternalnonsynonymous SNVNM_033427c.G1693Ap.V565I13.87-Guo2018 T
CTTNBP2     HN0016.p1chr7:
CAACexonicMaternalframeshift deletionNM_033427c.2651_2652delp.F884fs--Guo2018 T
CTTNBP2     AU4483301chr7:
CGintronicDe novo--Trost2022 G
Yuen2017 G
CTTNBP2     13918.p1chr7:
GGAintergenicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
CTTNBP2     AU4173301chr7:
AGintergenicDe novo--Yuen2017 G
CTTNBP2     GX0131.p1chr7:
CAexonicPaternalstopgainNM_033427c.G2461Tp.G821X38.0-Guo2018 T
CTTNBP2     GX0225.p1chr7:
ACAexonicPaternalframeshift deletionNM_033427c.4814delGp.G1605fs--Guo2018 T
CTTNBP2     AU050604chr7:
TCintergenicDe novo--Yuen2017 G
CTTNBP2     GX0233.p1chr7:
GCexonicPaternalstopgainNM_033427c.C2445Gp.Y815X36.0-Guo2018 T
CTTNBP2     GX0187.p1chr7:
ATAexonicPaternalframeshift deletionNM_033427c.4457delAp.N1486fs--Guo2018 T
CTTNBP2     SSC06432chr7:
TCATexonicDe novoframeshift deletionNM_033427c.2279_2280delp.V760fs--Fu2022 E
Trost2022 G
CTTNBP2     2-1581-003chr7:
CTintergenicDe novo--Yuen2017 G
CTTNBP2     1-0330-003chr7:
TGTintergenicDe novo--Yuen2017 G
CTTNBP2     M08434chr7:
TCexonicUnknownnonsynonymous SNVNM_033427c.A3502Gp.K1168E22.6-Guo2018 T
CTTNBP2     M19802chr7:
GAexonicUnknown, Paternalnonsynonymous SNVNM_033427c.C2357Tp.A786V25.4-Guo2018 T
Stessman2017 T
CTTNBP2     GX0054.p1chr7:
CAexonicPaternalnonsynonymous SNVNM_033427c.G2798Tp.C933F22.6-Guo2018 T
CTTNBP2     JS0056.p1chr7:
CTexonicPaternalnonsynonymous SNVNM_033427c.G1436Ap.R479H20.89.884E-5Guo2018 T
CTTNBP2     M30901chr7:
CTexonicPaternalnonsynonymous SNVNM_033427c.G3136Ap.G1046S18.495.771E-5Guo2018 T
CTTNBP2     HEN0251.p1chr7:
GCexonicPaternalnonsynonymous SNVNM_033427c.C1807Gp.L603V2.019-Guo2018 T
CTTNBP2     SX0012.p1chr7:
AACexonicMaternalframeshift insertionNM_033427c.3947dupGp.R1316fs-4.123E-5Guo2018 T
CTTNBP2     M30790chr7:
CTexonicPaternalnonsynonymous SNVNM_033427c.G589Ap.A197T4.9562.471E-5Guo2018 T
CTTNBP2     HN0137.p1chr7:
CTexonicPaternalnonsynonymous SNVNM_033427c.G589Ap.A197T4.9562.471E-5Guo2018 T
CTTNBP2     2-1131-003chr7:
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
CTTNBP2     AU3517301chr7:
GACACACACACGACACACACintergenicDe novo--Yuen2017 G
CTTNBP2     M32940chr7:
CAACexonicMaternalframeshift deletionNM_033427c.2651_2652delp.F884fs--Guo2018 T
CTTNBP2     M32047chr7:
TCexonicPaternalnonsynonymous SNVNM_033427c.A1582Gp.S528G8.646-Guo2018 T
CTTNBP2     SD0003.p1chr7:
CTexonicPaternalnonsynonymous SNVNM_033427c.G589Ap.A197T4.9562.471E-5Guo2018 T
CTTNBP2     AU1067302chr7:
GAexonicUnknownnonsynonymous SNVNM_033427c.C124Tp.R42W23.61.0E-4Stessman2017 T
CTTNBP2     HN0079.p1chr7:
CTexonicPaternalnonsynonymous SNVNM_033427c.G4033Ap.G1345R23.18.292E-6Guo2018 T
CTTNBP2     M23107chr7:
CTexonicUnknown, Paternalnonsynonymous SNVNM_033427c.G4033Ap.G1345R23.18.292E-6Guo2018 T
Stessman2017 T
CTTNBP2     GX0120.p1chr7:
GAexonicPaternalnonsynonymous SNVNM_033427c.C4402Tp.R1468C14.435.774E-5Guo2018 T
CTTNBP2     HN0099.p1chr7:
CAexonicPaternalnonsynonymous SNVNM_033427c.G3530Tp.S1177I15.488.262E-5Guo2018 T
CTTNBP2     GX0425.p1chr7:
GCexonicPaternalnonsynonymous SNVNM_033427c.C3899Gp.P1300R18.171.0E-4Guo2018 T
CTTNBP2     2-0208-003chr7:
CGintergenicDe novo--Yuen2017 G
CTTNBP2     HEN0307.p1chr7:
AACexonicMaternalframeshift insertionNM_033427c.3947dupGp.R1316fs-4.123E-5Guo2018 T
CTTNBP2     AU3451301chr7:
ACintergenicDe novo--Yuen2017 G
CTTNBP2     iHART2643chr7:
TCsplicingPaternalsplicing13.02-Ruzzo2019 G
CTTNBP2     iHART1048chr7:
CAGCexonicMaternalframeshift deletionNM_033427c.4498_4499delp.L1500fs--Ruzzo2019 G
CTTNBP2     iHART2644chr7:
TCsplicingPaternalsplicing13.02-Ruzzo2019 G
CTTNBP2     AU072505chr7:
TGintronicDe novo--Trost2022 G
Yuen2017 G
CTTNBP2     2-0129-005chr7:
CTintronicDe novo--Yuen2017 G
CTTNBP2     13070.p1 Complex Event; expand row to view variants  De novoframeshift deletionNM_033427
--Dong2014 E
Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2014 T
Satterstrom2020 E
Wilfert2021 G
Willsey2013 E
Zhou2022 GE
CTTNBP2     AU1446301chr7:
ACexonicMaternalstopgainNM_033427c.T3360Gp.Y1120X37.0-Stessman2017 T
CTTNBP2     SP0059686chr7:
GTexonicDe novononsynonymous SNVNM_033427c.C3402Ap.D1134E13.73-Fu2022 E
Zhou2022 GE
CTTNBP2     SP0048906chr7:
CAexonicDe novononsynonymous SNVNM_033427c.G4403Tp.R1468L9.003-Fu2022 E
Trost2022 G
Zhou2022 GE
CTTNBP2     5-0018-003chr7:
ACintronicDe novo--Trost2022 G
Yuen2017 G
CTTNBP2     M20562chr7:
GAexonicMaternalnonsynonymous SNVNM_033427c.C3970Tp.R1324C32.04.123E-5Wang2016 T
CTTNBP2     2-1693-003chr7:
GAintergenicDe novo--Yuen2017 G
CTTNBP2     211-5657-3chr7:
CTexonicUnknownnonsynonymous SNVNM_033427c.G3812Ap.R1271Q33.01.653E-5Stessman2017 T
CTTNBP2     GX0184.p1chr7:
CTexonicMaternalnonsynonymous SNVNM_033427c.G4033Ap.G1345R23.18.292E-6Guo2018 T
CTTNBP2     GX0206.p1chr7:
AGexonicMaternalnonsynonymous SNVNM_033427c.T4592Cp.V1531A18.06-Guo2018 T
CTTNBP2     GX0094.p1chr7:
ATexonicMaternalnonsynonymous SNVNM_033427c.T1765Ap.S589T12.298.239E-6Guo2018 T
CTTNBP2     GX0038.p1chr7:
CAexonicMaternalnonsynonymous SNVNM_033427c.G3530Tp.S1177I15.488.262E-5Guo2018 T
CTTNBP2     M08781chr7:
CTexonicDe novononsynonymous SNVNM_033427c.G4487Ap.R1496K11.2-Guo2018 T
CTTNBP2     GX0318.p1chr7:
ACexonicMaternalnonsynonymous SNVNM_033427c.T4665Gp.D1555E15.913.495E-5Guo2018 T
CTTNBP2     GX0448.p1chr7:
TCexonicMaternalnonsynonymous SNVNM_033427c.A923Gp.Q308R17.65-Guo2018 T
CTTNBP2     HN0093.p1chr7:
ATexonicMaternalnonsynonymous SNVNM_033427c.T1765Ap.S589T12.298.239E-6Guo2018 T
CTTNBP2     GX0232.p1chr7:
TGexonicMaternalnonsynonymous SNVNM_033427c.A657Cp.R219S15.058.258E-6Guo2018 T
CTTNBP2     AU2215302chr7:
TCintergenicDe novo--Yuen2017 G
CTTNBP2     HN0051.p1chr7:
GCexonicMaternalnonsynonymous SNVNM_033427c.C839Gp.S280C15.074.942E-5Guo2018 T
CTTNBP2     2-1744-003chr7:
GTexonicDe novononsynonymous SNVNM_033427c.C1444Ap.L482I13.57-Trost2022 G
Zhou2022 GE
CTTNBP2     1-0835-003chr7:
TCintronicDe novo--Trost2022 G
Yuen2017 G
CTTNBP2     03C14363chr7:
AGAAexonicMaternalframeshift deletionNM_033427c.4497_4498delp.S1499fs--Stessman2017 T
CTTNBP2     J7S7Zchr7:
CACCexonicInheritedframeshift deletionNM_033427c.4071_4072delp.L1357fs--Stessman2017 T
CTTNBP2     M23828chr7:
GAexonicPaternalnonsynonymous SNVNM_033427c.C3970Tp.R1324C32.04.123E-5Wang2016 T
CTTNBP2     P4N4Wchr7:
CAexonicUnknownnonsynonymous SNVNM_033427c.G4663Tp.D1555Y22.05.268E-5Stessman2017 T
CTTNBP2     REACH000202chr7:
GTintronicDe novo--Trost2022 G
CTTNBP2     MSSNG00359-003chr7:
CAGCintronicDe novo--Trost2022 G
CTTNBP2     1-1186-003chr7:
CTintronicDe novo--Trost2022 G
CTTNBP2     5-2015-003chr7:
CTintronicDe novo--Trost2022 G
CTTNBP2     2-1335-004chr7:
TGintergenicDe novo--Yuen2017 G
CTTNBP2     1-1180-003chr7:
CGintronicDe novo--Trost2022 G
CTTNBP2     MT_63.3chr7:
TGintronicDe novo--Trost2022 G
CTTNBP2     SSC09875chr7:
GGAintergenicDe novo--Trost2022 G
CTTNBP2     M27803chr7:
CTexonicPaternalnonsynonymous SNVNM_033427c.G2498Ap.G833E23.0-Guo2018 T
CTTNBP2     M15123chr7:
GAexonicPaternalnonsynonymous SNVNM_033427c.C3206Tp.A1069V5.3023.549E-5Guo2018 T
CTTNBP2     M19563chr7:
CTexonicPaternalnonsynonymous SNVNM_033427c.G2011Ap.V671I11.262.473E-5Guo2018 T
CTTNBP2     M20638chr7:
CTexonicPaternalnonsynonymous SNVNM_033427c.G2278Ap.V760M22.0-Guo2018 T
CTTNBP2     M12468chr7:
GAexonicPaternalnonsynonymous SNVNM_033427c.C3755Tp.A1252V19.59-Guo2018 T
CTTNBP2     M08674chr7:
CTexonicPaternalnonsynonymous SNVNM_033427c.G4487Ap.R1496K11.2-Guo2018 T
CTTNBP2     M30841chr7:
GAexonicPaternalnonsynonymous SNVNM_033427c.C3272Tp.P1091L11.38-Guo2018 T
CTTNBP2     M08494chr7:
CTexonicPaternalnonsynonymous SNVNM_033427c.G3388Ap.G1130R26.9-Guo2018 T
CTTNBP2     14015.p1chr7:
CGintergenicDe novo--Turner2016 G
CTTNBP2     M20709chr7:
ATexonicPaternalnonsynonymous SNVNM_033427c.T1067Ap.I356N9.516-Guo2018 T
CTTNBP2     M23062chr7:
CTexonicPaternalnonsynonymous SNVNM_033427c.G1160Ap.S387N12.61-Guo2018 T
CTTNBP2     M16097chr7:
TCexonicPaternalnonsynonymous SNVNM_033427c.A301Gp.K101E17.972.472E-5Guo2018 T
CTTNBP2     M26781chr7:
AGexonicPaternalnonsynonymous SNVNM_033427c.T797Cp.I266T12.162.0E-4Guo2018 T
CTTNBP2     M13281chr7:
GCexonicPaternalnonsynonymous SNVNM_033427c.C1271Gp.P424R6.1138.236E-6Guo2018 T
CTTNBP2     M15021chr7:
GAexonicPaternalnonsynonymous SNVNM_033427c.C1898Tp.T633M20.4-Guo2018 T
CTTNBP2     M08976chr7:
TCexonicPaternalnonsynonymous SNVNM_033427c.A1189Gp.S397G0.89-Guo2018 T
CTTNBP2     M12414chr7:
GC/GexonicPaternal--Guo2018 T
CTTNBP2     217-14409-5180chr7:
GAexonicUnknownstopgainNM_033427c.C1606Tp.R536X16.37-Stessman2017 T
CTTNBP2     M17505chr7:
TC/TexonicPaternal--Guo2018 T
CTTNBP2     320877chr7:
ACTCAAsplicingInheritedsplicing--Stessman2017 T
CTTNBP2     07C65257chr7:
CTexonicUnknownnonsynonymous SNVNM_033427c.G4579Ap.E1527K22.56.593E-5Stessman2017 T
CTTNBP2     ER47534chr7:
GAexonicDe novononsynonymous SNVNM_033427c.C2752Tp.H918Y26.9-O’Roak2014 T
CTTNBP2     1-0051-005chr7:
ACintergenicDe novo--Yuen2017 G
CTTNBP2     HEN0099.p1chr7:
CTexonicMaternalnonsynonymous SNVNM_033427c.G4051Ap.V1351M24.0-Guo2018 T
CTTNBP2     HEN0273.p1chr7:
TCexonicMaternalnonsynonymous SNVNM_033427c.A4255Gp.R1419G18.622.472E-5Guo2018 T
CTTNBP2     HN0190.p1chr7:
AGexonicMaternalnonsynonymous SNVNM_033427c.T797Cp.I266T12.162.0E-4Guo2018 T
CTTNBP2     HEN0079.p1chr7:
TAexonicMaternalnonsynonymous SNVNM_033427c.A1096Tp.I366F5.7411.647E-5Guo2018 T
CTTNBP2     HEN0211.p1chr7:
GAexonicMaternalnonsynonymous SNVNM_033427c.C3206Tp.A1069V5.3023.549E-5Guo2018 T
CTTNBP2     SX0019.p1chr7:
GAexonicMaternalnonsynonymous SNVNM_033427c.C3215Tp.P1072L16.311.779E-5Guo2018 T
CTTNBP2     M32724chr7:
GA/GexonicMaternal--Guo2018 T
CTTNBP2     HEN0137.p1chr7:
GCexonicMaternalnonsynonymous SNVNM_033427c.C1465Gp.R489G17.41-Guo2018 T
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView