or
or
Exact

Results for "DSCAM"

Variant Events: 288

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DSCAM     2-0109-003chr21:
41522481-41522481
CTintronicDe novo--Trost2022 G
Yuen2017 G
DSCAM     AU026412chr21:
41711621-41711621
AGintronicDe novo--Yuen2017 G
DSCAM     12329_p1chr21:
41457527-41457527
ATsplicingDe novosplicing22.0-Fu2022 E
DSCAM     36967chr21:
41457640-41457640
TTTAexonicDe novostopgainNM_001271534
NM_001389
c.4020_4021insTA
c.4020_4021insTA
p.N1341_G1342delinsX
p.N1341_G1342delinsX
--Fu2022 E
Trost2022 G
DSCAM     13579.p1chr21:
41496072-41496072
GAintronicDe novo--Satterstrom2020 E
DSCAM     ACGC_M15207chr21:
41414453-41414453
GAexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.C5531T
c.C5531T
p.S1844L
p.S1844L
26.34.968E-5Wang2020 T
DSCAM     35970chr21:
41414330-41414330
AATexonicDe novoframeshift insertionNM_001271534
NM_001389
c.5653dupA
c.5653dupA
p.M1885fs
p.M1885fs
--Fu2022 E
Trost2022 G
DSCAM     AU2381302chr21:
42295777-42295777
CGintergenicDe novo--Yuen2017 G
DSCAM     1-0404-003chr21:
42144484-42144484
TCintronicDe novo--Trost2022 G
Yuen2017 G
DSCAM     M08314chr21:
41550907-41550907
CTexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.G2894A
c.G2894A
p.R965Q
p.R965Q
15.438.282E-6Guo2018 T
DSCAM     AGRE_05C48104chr21:
41414303-41414303
CTexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.G5681A
c.G5681A
p.R1894Q
p.R1894Q
35.0-Wang2020 T
DSCAM     Leuven2_61903563chr21:
41414303-41414303
CTexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.G5681A
c.G5681A
p.R1894Q
p.R1894Q
35.0-Wang2020 T
DSCAM     AGRE_AU1350302chr21:
41414303-41414303
CTexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.G5681A
c.G5681A
p.R1894Q
p.R1894Q
35.0-Wang2020 T
DSCAM     Gecz1_26513chr21:
41452079-41452079
CAexonicUnknownstopgainNM_001271534
NM_001389
c.G4420T
c.G4420T
p.E1474X
p.E1474X
39.08.532E-6Wang2020 T
DSCAM     ACGC_M15191chr21:
41452079-41452079
CAexonicMaternalstopgainNM_001271534
NM_001389
c.G4420T
c.G4420T
p.E1474X
p.E1474X
39.08.532E-6Wang2020 T
DSCAM     M01903chr21:
41719798-41719798
CC/TexonicMaternal--Guo2018 T
DSCAM     M01773chr21:
41684041-41684041
CC/TexonicMaternal--Guo2018 T
DSCAM     Gecz4_48979chr21:
41452079-41452079
CAexonicUnknownstopgainNM_001271534
NM_001389
c.G4420T
c.G4420T
p.E1474X
p.E1474X
39.08.532E-6Wang2020 T
DSCAM     AU1698302chr21:
41623751-41623751
CTintronicDe novo--Trost2022 G
Yuen2017 G
DSCAM     AGRE_AU080903chr21:
41561021-41561021
CTexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.G2501A
c.G2501A
p.R834H
p.R834H
31.08.281E-5Wang2020 T
DSCAM     Gecz4_47842chr21:
41561021-41561021
CTexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.G2501A
c.G2501A
p.R834H
p.R834H
31.08.281E-5Wang2020 T
DSCAM     AU1955302chr21:
42399713-42399713
CAintergenicDe novo--Yuen2017 G
DSCAM     AGRE_AU1393304chr21:
41561021-41561021
CTexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.G2501A
c.G2501A
p.R834H
p.R834H
31.08.281E-5Wang2020 T
DSCAM     AU1955302chr21:
42399750-42399750
GCintergenicDe novo--Yuen2017 G
DSCAM     M23679chr21:
41539180-41539180
GAexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.C2983T
c.C2983T
p.P995S
p.P995S
18.974.971E-5Guo2018 T
Wang2016 T
DSCAM     ACGC_M27851chr21:
41719739-41719740
AGAexonicDe novoframeshift deletionNM_001271534
NM_001389
c.1067delC
c.1067delC
p.P356fs
p.P356fs
--Wang2020 T
DSCAM     2-1521-003chr21:
42393025-42393034
AAGAGAGAGAAAGAGAGAintergenicDe novo--Yuen2017 G
DSCAM     2-1356-003chr21:
42075468-42075483
CCACACACACACACACCCACACACACACACintronicDe novo--Yuen2017 G
DSCAM     ACGC_M17551chr21:
41446967-41446967
GAexonicDe novostopgainNM_001271534
NM_001389
c.C4885T
c.C4885T
p.R1629X
p.R1629X
41.0-Wang2020 T
DSCAM     ACGC_HEN0296.p1chr21:
41516424-41516424
CTexonicDe novononsynonymous SNVNM_001271534
NM_001389
c.G3253A
c.G3253A
p.E1085K
p.E1085K
24.5-Wang2020 T
DSCAM     13735.p1 Complex Event; expand row to view variants  De novoframeshift insertionNM_001271534
NM_001389
NM_001271534
NM_001389
c.5653dupA
c.5653dupA
c.5652dupA
c.5652dupA
p.M1885fs
p.M1885fs
p.M1885fs
p.M1885fs
--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2014 T
Satterstrom2020 E
Wang2020 T
Zhou2022 GE
DSCAM     AU3853302 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
DSCAM     12329.p1chr21:
41457527-41457527
ATsplicingDe novosplicing22.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
O’Roak2014 T
Satterstrom2020 E
Trost2022 G
Wang2020 T
Wilfert2021 G
Zhou2022 GE
DSCAM     14597.p1 Complex Event; expand row to view variants  De novoframeshift insertion, stopgainNM_001271534
NM_001389
NM_001271534
NM_001389
c.4020_4021insTA
c.4020_4021insTA
c.4019_4020insTA
c.4019_4020insTA
p.N1341_G1342delinsX
p.N1341_G1342delinsX
p.S1340fs
p.S1340fs
--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2014 T
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
Zhou2022 GE
DSCAM     AU3605303chr21:
41916432-41916435
CATACAintronicDe novo--Yuen2017 G
DSCAM     GX0447.p1chr21:
41719720-41719720
TCexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.A1087G
c.A1087G
p.T363A
p.T363A
11.341.656E-5Guo2018 T
DSCAM     GX0128.p1chr21:
41684085-41684085
AGexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.T1985C
c.T1985C
p.M662T
p.M662T
6.789-Guo2018 T
DSCAM     HN0097.p1chr21:
41725407-41725407
GAexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.C919T
c.C919T
p.R307C
p.R307C
18.03.0E-4Guo2018 T
DSCAM     M32128chr21:
41725407-41725407
GAexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.C919T
c.C919T
p.R307C
p.R307C
18.03.0E-4Guo2018 T
DSCAM     M30585chr21:
41514631-41514631
AGexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.T3260C
c.T3260C
p.V1087A
p.V1087A
18.11-Guo2018 T
DSCAM     AU1350302chr21:
41414303-41414303
CTexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.G5681A
c.G5681A
p.R1894Q
p.R1894Q
35.0-Stessman2017 T
DSCAM     HN0070.p1chr21:
41385122-41385125
CTTCCexonicPaternalnonframeshift deletionNM_001271534
NM_001389
c.5821_5823del
c.5875_5877del
p.1941_1941del
p.1959_1959del
--Guo2018 T
DSCAM     GX0512.p1chr21:
41725560-41725560
ATexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.T766A
c.T766A
p.Y256N
p.Y256N
22.48.312E-6Guo2018 T
DSCAM     2-1288-003chr21:
41813343-41813343
TCintronicDe novo--Trost2022 G
Yuen2017 G
DSCAM     SSC12309chr21:
41457640-41457640
TTTAexonicstopgainNM_001271534
NM_001389
c.4020_4021insTA
c.4020_4021insTA
p.N1341_G1342delinsX
p.N1341_G1342delinsX
--Antaki2022 GE
DSCAM     2-1288-003chr21:
41542779-41542779
CTintronicDe novo--Trost2022 G
Yuen2017 G
DSCAM     AU2140306chr21:
42345900-42345900
CTintergenicDe novo--Yuen2017 G
DSCAM     SSC04501chr21:
41457527-41457527
ATsplicingsplicing22.0-Antaki2022 GE
DSCAM     AU2000302chr21:
42502694-42502694
GCintergenicDe novo--Yuen2017 G
DSCAM     1-0138-003chr21:
41589460-41589460
ACintronicDe novo--Trost2022 G
Yuen2017 G
DSCAM     1-0323-003chr21:
41965911-41965911
GAintronicDe novo--Trost2022 G
Yuen2017 G
DSCAM     5-5098-003chr21:
41561011-41561011
CTexonicDe novosynonymous SNVNM_001271534
NM_001389
c.G2511A
c.G2511A
p.V837V
p.V837V
--Trost2022 G
Zhou2022 GE
DSCAM     AU2000302chr21:
42496629-42496629
GCintergenicDe novo--Yuen2017 G
DSCAM     AU075210chr21:
41417986-41417986
CTintronicDe novo--Trost2022 G
Yuen2017 G
DSCAM     1-0099-003chr21:
41964219-41964219
CAintronicDe novo--Trost2022 G
Yuen2017 G
DSCAM     2-0225-004chr21:
41710273-41710278
ATGTTTAexonicUnknownframeshift deletionNM_001271534
NM_001389
c.1533_1537del
c.1533_1537del
p.K511fs
p.K511fs
--Wang2020 T
DSCAM     M14989chr21:
41452148-41452148
GCexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.C4351G
c.C4351G
p.L1451V
p.L1451V
10.79-Guo2018 T
Wang2016 T
DSCAM     M15105chr21:
41457647-41457647
GCexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.C4014G
c.C4014G
p.I1338M
p.I1338M
16.213.315E-5Guo2018 T
Wang2016 T
DSCAM     5-0041-003chr21:
42134176-42134176
TCintronicDe novo--Trost2022 G
Yuen2017 G
DSCAM     5-0041-003chr21:
42310003-42310003
GCintergenicDe novo--Yuen2017 G
DSCAM     M17688chr21:
41457647-41457647
GCexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.C4014G
c.C4014G
p.I1338M
p.I1338M
16.213.315E-5Guo2018 T
Wang2016 T
DSCAM     2-1632-003chr21:
42452300-42452300
CAintergenicDe novo--Yuen2017 G
DSCAM     AU3768302chr21:
41552537-41552537
GAintronicDe novo--Trost2022 G
Yuen2017 G
DSCAM     AU4145303 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
DSCAM     1-0330-004chr21:
41876119-41876120
AGAintronicDe novo--Trost2022 G
Yuen2017 G
DSCAM     1-0224-004chr21:
42002711-42002711
CTintronicDe novo--Trost2022 G
Yuen2017 G
DSCAM     ACGC_M01903chr21:
41719798-41719798
CTexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.G1009A
c.G1009A
p.V337M
p.V337M
26.01.657E-5Wang2020 T
DSCAM     ACGC_M32047chr21:
41457637-41457637
CTexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.G4024A
c.G4024A
p.G1342R
p.G1342R
33.01.657E-5Wang2020 T
DSCAM     M10003chr21:
41416053-41416053
CGexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.G5335C
c.G5335C
p.V1779L
p.V1779L
18.23-Guo2018 T
Wang2016 T
DSCAM     ACGC_M31817chr21:
41385260-41385260
CTsplicing;exonicMaternalnonsynonymous SNVNM_001389c.G5740Ap.G1914S13.27-Wang2020 T
DSCAM     ACGC_M32047chr21:
41725626-41725626
GAexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.C700T
c.C700T
p.R234C
p.R234C
20.6-Wang2020 T
DSCAM     S7J3Dchr21:
41719645-41719645
GAexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.C1162T
c.C1162T
p.R388C
p.R388C
18.498.28E-6Stessman2017 T
DSCAM     1-0224-004chr21:
42018619-42018619
TCintronicDe novo--Trost2022 G
Yuen2017 G
DSCAM     2-0299-003chr21:
42054431-42054431
AAAGAGAGAAAGAGAGAGAGAAAGAGAGAAAGAGAGAGintronicDe novo--Yuen2017 G
DSCAM     AU070703chr21:
42050453-42050453
CTintronicDe novo--Trost2022 G
Yuen2017 G
DSCAM     M18334chr21:
41446993-41446993
CTexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.G4859A
c.G4859A
p.R1620Q
p.R1620Q
34.08.309E-6Guo2018 T
Wang2016 T
DSCAM     1-0628-004Achr21:
41483895-41483895
GAintronicDe novo--Trost2022 G
DSCAM     1-0633-003chr21:
41481396-41481396
ACintronicDe novo--Trost2022 G
DSCAM     4-0081-003chr21:
41461212-41461212
TAintronicDe novo--Trost2022 G
DSCAM     4-0062-003chr21:
41432250-41432252
TAGGACintronicDe novo--Trost2022 G
DSCAM     3-0409-000chr21:
41425728-41425728
GAintronicDe novo--Trost2022 G
DSCAM     AU2310301chr21:
41423707-41423707
AGintronicDe novo--Trost2022 G
DSCAM     MSSNG00014-003chr21:
41389865-41389865
ACintronicDe novo--Trost2022 G
DSCAM     2-1504-003chr21:
41670273-41670273
GGCintronicDe novo--Trost2022 G
DSCAM     7-0334-003chr21:
41655158-41655158
CTintronicDe novo--Trost2022 G
DSCAM     7-0337-004chr21:
41546858-41546858
GCintronicDe novo--Trost2022 G
DSCAM     2-1790-003chr21:
41543295-41543295
AGintronicDe novo--Trost2022 G
DSCAM     H3E8D_01chr21:
41517948-41517948
CTintronicDe novo--Trost2022 G
DSCAM     SJD_27.3chr21:
41510406-41510407
TGTintronicDe novo--Trost2022 G
DSCAM     2-1407-003chr21:
42368727-42368727
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
DSCAM     1-0018-003chr21:
41507931-41507931
GAintronicDe novo--Trost2022 G
DSCAM     SSC08001chr21:
41496072-41496072
GAintronicDe novo--Trost2022 G
DSCAM     MSSNG00023-003chr21:
41840889-41840889
ATintronicDe novo--Trost2022 G
DSCAM     3-0610-000chr21:
41815942-41815942
TCintronicDe novo--Trost2022 G
DSCAM     3-0533-000chr21:
41799187-41799187
CTintronicDe novo--Trost2022 G
DSCAM     1-0838-003chr21:
41795656-41795656
GCintronicDe novo--Trost2022 G
DSCAM     3-0178-000chr21:
41720186-41720186
CGintronicDe novo--Trost2022 G
DSCAM     REACH000349chr21:
41720018-41720018
TCintronicDe novo--Trost2022 G
DSCAM     5-5146-004chr21:
41708908-41708908
TCintronicDe novo--Trost2022 G
DSCAM     7-0198-003chr21:
41673522-41673522
TTAGCCTTTATTACACTCATCTGGTACCACintronicDe novo--Trost2022 G
DSCAM     SF0010765.p1chr21:
41711153-41711153
CAexonicnonsynonymous SNVNM_001271534
NM_001389
c.G1400T
c.G1400T
p.S467I
p.S467I
15.59-Wang2020 T
DSCAM     5-5015-003chr21:
41883564-41883564
CAintronicDe novo--Trost2022 G
DSCAM     SF0047472.p1chr21:
41561063-41561063
CTexonicnonsynonymous SNVNM_001271534
NM_001389
c.G2459A
c.G2459A
p.R820H
p.R820H
33.01.657E-5Wang2020 T
DSCAM     7-0260-003chr21:
41880851-41880851
AGintronicDe novo--Trost2022 G
DSCAM     MSSNG00072-003chr21:
41880270-41880270
AGintronicDe novo--Trost2022 G
DSCAM     AU2698301chr21:
41875960-41875960
GTintronicDe novo--Trost2022 G
DSCAM     3-0346-000chr21:
41874593-41874593
TCintronicDe novo--Trost2022 G
DSCAM     REACH000327chr21:
41870020-41870020
GAintronicDe novo--Trost2022 G
DSCAM     1-0323-004chr21:
41881073-41881073
TCintronicDe novo--Trost2022 G
Yuen2017 G
DSCAM     SF0045094.p1chr21:
41465761-41465761
TCexonicnonsynonymous SNVNM_001271534
NM_001389
c.A3737G
c.A3737G
p.Y1246C
p.Y1246C
16.68-Wang2020 T
DSCAM     MSSNG00229-003chr21:
41853223-41853223
CTintronicDe novo--Trost2022 G
DSCAM     MSSNG00003-004chr21:
41847367-41847367
GCintronicDe novo--Trost2022 G
DSCAM     3-0454-000chr21:
41966754-41966754
GAintronicDe novo--Trost2022 G
DSCAM     1-0090-003chr21:
41959268-41959268
ATintronicDe novo--Trost2022 G
DSCAM     M01613chr21:
41414439-41414439
CC/TexonicPaternal--Guo2018 T
DSCAM     3-0544-000chr21:
41941862-41941862
GAintronicDe novo--Trost2022 G
DSCAM     AU2687301chr21:
41935409-41935409
TCintronicDe novo--Trost2022 G
DSCAM     MT_21.3chr21:
41931069-41931069
GCintronicDe novo--Trost2022 G
DSCAM     REACH000650chr21:
41922386-41922386
GCintronicDe novo--Trost2022 G
DSCAM     320877chr21:
41559142-41559142
GAexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.C2695T
c.C2695T
p.R899C
p.R899C
19.681.659E-5Stessman2017 T
DSCAM     MSSNG00348-003chr21:
41912161-41912161
TCintronicDe novo--Trost2022 G
DSCAM     14686.p1chr21:
41550837-41550837
CTintronicMosaic-8.356E-6Dou2017 E
DSCAM     MSSNG00390-003chr21:
41887931-41887931
TGintronicDe novo--Trost2022 G
DSCAM     M08698chr21:
41741119-41741119
TCexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.A562G
c.A562G
p.N188D
p.N188D
17.36-Guo2018 T
DSCAM     REACH000426chr21:
42100064-42100064
GAintronicDe novo--Trost2022 G
DSCAM     M12365chr21:
41725605-41725605
GAexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.C721T
c.C721T
p.R241C
p.R241C
20.4-Guo2018 T
DSCAM     MT_160.4chr21:
42084216-42084216
CTintronicDe novo--Trost2022 G
DSCAM     MSSNG00108-003chr21:
42054754-42054754
GAintronicDe novo--Trost2022 G
DSCAM     M19682chr21:
41446993-41446993
CTexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.G4859A
c.G4859A
p.R1620Q
p.R1620Q
34.08.309E-6Guo2018 T
Wang2016 T
DSCAM     MSSNG00019-003Achr21:
42054754-42054754
GAintronicDe novo--Trost2022 G
DSCAM     M08473chr21:
41684227-41684227
TCexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.A1843G
c.A1843G
p.I615V
p.I615V
10.16-Guo2018 T
DSCAM     REACH000626chr21:
42048639-42048639
TCintronicDe novo--Trost2022 G
DSCAM     2-1725-003chr21:
42003372-42003372
GAintronicDe novo--Yuen2017 G
DSCAM     M21662chr21:
41427654-41427654
AGexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.T5033C
c.T5033C
p.I1678T
p.I1678T
16.48-Guo2018 T
DSCAM     M08563chr21:
41719720-41719720
TCexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.A1087G
c.A1087G
p.T363A
p.T363A
11.341.656E-5Guo2018 T
DSCAM     AU2604301chr21:
41985424-41985426
CAACintronicDe novo--Trost2022 G
DSCAM     3-0430-000chr21:
42366300-42366300
CTintergenicDe novo--Yuen2016 G
DSCAM     M15179chr21:
41719627-41719627
CTexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.G1180A
c.G1180A
p.A394T
p.A394T
18.948.281E-6Guo2018 T
DSCAM     5-1012-004chr21:
41975120-41975120
TCintronicDe novo--Trost2022 G
DSCAM     1-1169-003chr21:
42189423-42189423
ACintronicDe novo--Trost2022 G
DSCAM     AU084Achr21:
41648022-41648022
ACsplicingDe novo, Unknownsplicing27.3-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
Wang2020 T
Zhou2022 GE
DSCAM     2-1334-003chr21:
42077744-42077744
TCintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
DSCAM     MSSNG00341-004chr21:
42186950-42186950
AGintronicDe novo--Trost2022 G
DSCAM     5-5031-003chr21:
42173880-42173880
CAintronicDe novo--Trost2022 G
DSCAM     REACH000653chr21:
42171322-42171323
GAGintronicDe novo--Trost2022 G
DSCAM     2-0198-004chr21:
41468580-41468580
ATintronicDe novo--Trost2022 G
Yuen2017 G
DSCAM     MSSNG00044-004chr21:
42153586-42153586
TAintronicDe novo--Trost2022 G
DSCAM     5-5171-003chr21:
42107077-42107077
GAintronicDe novo--Trost2022 G
DSCAM     SP0081089chr21:
41447183-41447183
GAintronicDe novo-2.56E-5Fu2022 E
DSCAM     SP0010765chr21:
41711153-41711153
CAexonicDe novononsynonymous SNVNM_001271534
NM_001389
c.G1400T
c.G1400T
p.S467I
p.S467I
15.59-Fu2022 E
Trost2022 G
Zhou2022 GE
DSCAM     GX0542.p1chr21:
41447089-41447089
GAexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.C4763T
c.C4763T
p.T1588M
p.T1588M
12.982.485E-5Guo2018 T
DSCAM     SP0127493chr21:
41514395-41514395
TGintronicDe novo--Fu2022 E
DSCAM     JS0029.p1chr21:
41385179-41385179
TCexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.A5767G
c.A5821G
p.T1923A
p.T1941A
6.569-Guo2018 T
DSCAM     SP0140612chr21:
41465623-41465623
TGintronicDe novo--Fu2022 E
DSCAM     2-0270-003chr21:
41835112-41835115
CATTCintronicDe novo--Trost2022 G
Yuen2017 G
DSCAM     SP0045094chr21:
41465761-41465761
TCexonicDe novononsynonymous SNVNM_001271534
NM_001389
c.A3737G
c.A3737G
p.Y1246C
p.Y1246C
16.68-Fu2022 E
Trost2022 G
Zhou2022 GE
DSCAM     SP0047472chr21:
41561063-41561063
CTexonicDe novononsynonymous SNVNM_001271534
NM_001389
c.G2459A
c.G2459A
p.R820H
p.R820H
33.01.657E-5Fu2022 E
Trost2022 G
Zhou2022 GE
DSCAM     HEN0021.p1chr21:
41725503-41725503
CTexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.G823A
c.G823A
p.V275M
p.V275M
16.137.466E-5Guo2018 T
DSCAM     HEN0114.p1chr21:
41551021-41551021
TCexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.A2780G
c.A2780G
p.D927G
p.D927G
14.11.663E-5Guo2018 T
DSCAM     JS0059.p1chr21:
41505922-41505922
TCexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.A3421G
c.A3421G
p.K1141E
p.K1141E
16.23-Guo2018 T
DSCAM     SP0096681chr21:
41516330-41516330
GCintronicDe novo--Fu2022 E
DSCAM     SX0019.p1chr21:
41719761-41719761
CC/TexonicMaternal--Guo2018 T
DSCAM     Mahjani2021:144chr21:
41447108-41447108
GAexonicstopgainNM_001271534
NM_001389
c.C4744T
c.C4744T
p.Q1582X
p.Q1582X
43.0-Mahjani2021 E
DSCAM     HEN0250.p1chr21:
41668000-41668000
CTexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.G2164A
c.G2164A
p.V722M
p.V722M
9.4344.978E-5Guo2018 T
DSCAM     Stessman2017:ASD_1340chr21:
41423896-41423896
CTexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.G5174A
c.G5174A
p.R1725Q
p.R1725Q
36.02.493E-5Stessman2017 T
DSCAM     M13459chr21:
41505796-41505796
GAexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.C3547T
c.C3547T
p.R1183W
p.R1183W
20.98.611E-6Stessman2017 T
DSCAM     NDAR_INVRB928JBD_wes1chr21:
41496267-41496267
GCintronicDe novo--Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
DSCAM     1-0186-004chr21:
42013793-42013793
GAintronicDe novo--Trost2022 G
Yuen2017 G
DSCAM     AU061104chr21:
42171823-42171823
CGintronicDe novo--Yuen2017 G
DSCAM     M31817chr21:
41385260-41385260
CTsplicing;exonicMaternalnonsynonymous SNVNM_001389c.G5740Ap.G1914S13.27-Guo2018 T
DSCAM     M13459chr21:
41465723-41465723
CTexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.G3775A
c.G3775A
p.V1259I
p.V1259I
12.723.0E-4Wang2016 T
DSCAM     M21615chr21:
41465723-41465723
CTexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.G3775A
c.G3775A
p.V1259I
p.V1259I
12.723.0E-4Wang2016 T
DSCAM     AU3716301chr21:
41396115-41396115
GAintronicDe novo--Yuen2017 G
DSCAM     M15242chr21:
41450679-41450679
CTexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.G4646A
c.G4646A
p.R1549Q
p.R1549Q
25.18.292E-6Guo2018 T
Wang2016 T
DSCAM     M8314chr21:
41550907-41550907
CTexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.G2894A
c.G2894A
p.R965Q
p.R965Q
15.438.282E-6Wang2016 T
DSCAM     PN400385chr21:
41414453-41414453
GAexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.C5531T
c.C5531T
p.S1844L
p.S1844L
26.34.968E-5Leblond2019 E
DSCAM     1-0282-003chr21:
41873131-41873134
ATATAintronicDe novo--Trost2022 G
Yuen2017 G
DSCAM     M15191chr21:
41452079-41452079
CAexonicMaternalstopgainNM_001271534
NM_001389
c.G4420T
c.G4420T
p.E1474X
p.E1474X
39.08.532E-6Guo2018 T
Wang2016 T
DSCAM     M17542chr21:
41514487-41514487
CAexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.G3404T
c.G3404T
p.G1135V
p.G1135V
25.6-Guo2018 T
Wang2016 T
DSCAM     5-0084-003chr21:
42306275-42306275
GAintergenicDe novo--Yuen2017 G
DSCAM     JS0074.p1chr21:
41719669-41719669
CTexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.G1138A
c.G1138A
p.G380R
p.G380R
11.45-Guo2018 T
DSCAM     M32733chr21:
41684059-41684059
CTexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.G2011A
c.G2011A
p.A671T
p.A671T
20.3-Guo2018 T
DSCAM     M19636chr21:
41719630-41719630
ACexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.T1177G
c.T1177G
p.S393A
p.S393A
19.428.281E-6Guo2018 T
Wang2016 T
DSCAM     2-0198-005chr21:
41468580-41468580
ATintronicDe novo--Yuen2017 G
DSCAM     HEN0273.p1chr21:
41385089-41385089
ACexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.T5857G
c.T5911G
p.L1953V
p.L1971V
14.01-Guo2018 T
DSCAM     SAGE_BK823-01chr21:
41423896-41423896
CTexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.G5174A
c.G5174A
p.R1725Q
p.R1725Q
36.02.493E-5Wang2020 T
DSCAM     HEN0243.p1chr21:
41550907-41550907
CTexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.G2894A
c.G2894A
p.R965Q
p.R965Q
15.438.282E-6Guo2018 T
DSCAM     AU1988301chr21:
42306617-42306617
ACintergenicDe novo--Yuen2017 G
DSCAM     SD0085.p1chr21:
41427654-41427654
AGexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.T5033C
c.T5033C
p.I1678T
p.I1678T
16.48-Guo2018 T
DSCAM     Melbourne2_ASD_1340chr21:
41423896-41423896
CTexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.G5174A
c.G5174A
p.R1725Q
p.R1725Q
36.02.493E-5Wang2020 T
DSCAM     M17452chr21:
41385061-41385061
CTexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.G5885A
c.G5939A
p.G1962E
p.G1980E
14.92-Wang2016 T
DSCAM     14228.p1chr21:
41467503-41467503
GAintronicDe novo--Wilfert2021 G
DSCAM     M17574chr21:
41450767-41450767
CTexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.G4558A
c.G4558A
p.V1520I
p.V1520I
13.17-Wang2016 T
DSCAM     ACGC_M08781chr21:
41741085-41741085
GAexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.C596T
c.C596T
p.T199M
p.T199M
31.01.66E-5Wang2020 T
DSCAM     13812.p1chr21:
42005641-42005641
TCintronicDe novo--Wilfert2021 G
DSCAM     ACGC_M08674chr21:
41741085-41741085
GAexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.C596T
c.C596T
p.T199M
p.T199M
31.01.66E-5Wang2020 T
DSCAM     2-1358-003chr21:
41718168-41718168
TCintronicDe novo--Trost2022 G
Yuen2017 G
DSCAM     211-5257-3chr21:
41423956-41423956
GAexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.C5114T
c.C5114T
p.T1705M
p.T1705M
23.13.313E-5Stessman2017 T
DSCAM     5-0131-003chr21:
41639913-41639913
TTATACAAintronicDe novo--Trost2022 G
Yuen2017 G
DSCAM     M08781chr21:
41741085-41741085
GAexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.C596T
c.C596T
p.T199M
p.T199M
31.01.66E-5Guo2018 T
Wang2016 T
DSCAM     1-0162-004chr21:
41626417-41626417
TGintronicDe novo--Yuen2017 G
DSCAM     SAGE_560.03chr21:
41457640-41457640
TTTAexonicDe novostopgainNM_001271534
NM_001389
c.4020_4021insTA
c.4020_4021insTA
p.N1341_G1342delinsX
p.N1341_G1342delinsX
--Wang2020 T
DSCAM     5-0131-003chr21:
42300733-42300733
GAintergenicDe novo--Yuen2017 G
DSCAM     SAGE_555.03chr21:
41414330-41414330
AATexonicDe novoframeshift insertionNM_001271534
NM_001389
c.5653dupA
c.5653dupA
p.M1885fs
p.M1885fs
--Wang2020 T
DSCAM     TASC_217-14152-2510chr21:
41424010-41424010
GAexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.C5060T
c.C5060T
p.T1687M
p.T1687M
23.7-Wang2020 T
DSCAM     ACGC_HEN502.p1chr21:
41414304-41414304
GCexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.C5680G
c.C5680G
p.R1894G
p.R1894G
20.6-Wang2020 T
DSCAM     Naples_7589chr21:
41427670-41427670
CGexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.G5017C
c.G5017C
p.D1673H
p.D1673H
22.9-Wang2020 T
DSCAM     Leuven_320877chr21:
41559142-41559142
GAexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.C2695T
c.C2695T
p.R899C
p.R899C
19.681.659E-5Wang2020 T
DSCAM     Leuven_345299chr21:
41423968-41423968
GAexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.C5102T
c.C5102T
p.T1701M
p.T1701M
22.71.0E-4Wang2020 T
DSCAM     TASC_211-5257-3chr21:
41423956-41423956
GAexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.C5114T
c.C5114T
p.T1705M
p.T1705M
23.13.313E-5Wang2020 T
DSCAM     SAGE_BK_690_01chr21:
41684167-41684167
GAexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.C1903T
c.C1903T
p.R635W
p.R635W
20.63.0E-4Wang2020 T
DSCAM     M8563chr21:
41719720-41719720
TCexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.A1087G
c.A1087G
p.T363A
p.T363A
11.341.656E-5Wang2016 T
DSCAM     ACGC_SX0029.p1chr21:
41711265-41711265
CTexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.G1288A
c.G1288A
p.V430M
p.V430M
26.2-Wang2020 T
DSCAM     M17551chr21:
41446967-41446967
GAexonicDe novostopgainNM_001271534
NM_001389
c.C4885T
c.C4885T
p.R1629X
p.R1629X
41.0-Guo2018 T
Stessman2017 T
Stessman2017 T
Wang2016 T
DSCAM     M12516chr21:
42080494-42080494
TCexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.A247G
c.A247G
p.I83V
p.I83V
20.5-Guo2018 T
Wang2016 T
DSCAM     ACGC_SD0126.p1chr21:
41414441-41414441
GAexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.C5543T
c.C5543T
p.T1848M
p.T1848M
25.7-Wang2020 T
DSCAM     Leuven2_62732375chr21:
41447003-41447003
GAexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.C4849T
c.C4849T
p.R1617W
p.R1617W
19.571.659E-5Wang2020 T
DSCAM     M8473chr21:
41684227-41684227
TCexonicPaternalnonsynonymous SNVNM_001271534
NM_001389
c.A1843G
c.A1843G
p.I615V
p.I615V
10.16-Wang2016 T
DSCAM     SAGE_539.102chr21:
42064858-42064858
CTexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.G386A
c.G386A
p.R129H
p.R129H
29.4-Wang2020 T
DSCAM     AU4343302chr21:
41920657-41920657
AGintronicDe novo--Trost2022 G
Yuen2017 G
DSCAM     Leuven2_60887638chr21:
41414597-41414597
CAexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.G5387T
c.G5387T
p.R1796L
p.R1796L
23.5-Wang2020 T
DSCAM     2-1272-003chr21:
41634541-41634541
TCintronicDe novo--Yuen2016 G
DSCAM     Gecz4_49862chr21:
41414597-41414597
CAexo