or
or
Exact

Results for "MARCH2"

Variant Events: 8

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MARCH2     12529.p1chr19:
8504052-8504052
AGdownstreamDe novo--Turner2016 G
MARCH2     SP0071648chr19:
8503180-8503180
CTintronicDe novo--Fu2022 E
MARCH2     JASD_Fam0257chr19:
8495673-8495673
GTexonicDe novosynonymous SNVNM_001005415
NM_016496
c.G504T
c.G504T
p.R168R
p.R168R
--Takata2018 E
MARCH2     2-1529-003chr19:
8507306-8507319
CAGAGAGAGAGAGACAGAGAGAGAGAintergenicDe novo--Yuen2017 G
MARCH2     1-0630-003chr19:
8504429-8504430
CACdownstreamDe novo--Trost2022 G
MARCH2     AU2192301chr19:
8489982-8489982
GAintronicDe novo--Trost2022 G
MARCH2     REACH000476chr19:
8490426-8490426
GAintronicDe novo--Trost2022 G
MARCH2     3-0497-001chr19:
8488149-8488150
CATGintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More