or
or
Exact

Results for "SOX5"

Variant Events: 42

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SOX5     13171.p1chr12:
24339722-24339722
CGintronicDe novo--Turner2016 G
SOX5     2-0013-003chr12:
23864083-23864083
GAintronicDe novo--Yuen2017 G
SOX5     1-0336-003chr12:
23685371-23685371
AACTTUTR3De novo--Yuen2017 G
SOX5     2-1398-003chr12:
24118124-24118124
CTintronicDe novo--Yuen2017 G
SOX5     AU047703chr12:
23740521-23740521
GAintronicDe novo--Yuen2017 G
SOX5     1-0138-003chr12:
23752526-23752526
CCCGTTTAAACAAAGTTTAAAATACTATTAAAintronicDe novo--Yuen2017 G
SOX5     AU055004chr12:
24375965-24375965
ATintronicDe novo--Yuen2017 G
SOX5     11508.p1chr12:
23879549-23879549
CTintronicDe novo--Werling2018 G
SOX5     2-1336-003chr12:
24567360-24567360
AAAAAGTTGGTTintronicDe novo--Yuen2017 G
SOX5     7-0133-003chr12:
23999046-23999046
GAexonicDe novostopgainNM_001261415
NM_006940
NM_152989
NM_001261414
c.C322T
c.C352T
c.C313T
c.C313T
p.R108X
p.R118X
p.R105X
p.R105X
36.0-Yuen2017 G
SOX5     AU2140306chr12:
24230198-24230198
CTintronicDe novo--Yuen2017 G
SOX5     3-0428-000chr12:
23795548-23795548
TCintronicDe novo--Yuen2016 G
SOX5     3B568chr12:
23793761-23793761
GAexonicDe novosynonymous SNVNM_001261415
NM_006940
NM_152989
NM_001261414
c.C972T
c.C1002T
c.C963T
c.C963T
p.G324G
p.G334G
p.G321G
p.G321G
--Satterstrom2020 E
SOX5     3-0430-000chr12:
24061106-24061106
AGintronicDe novo--Yuen2016 G
SOX5     AU024105chr12:
23843234-23843234
GAintronicDe novo--Yuen2017 G
SOX5     1-0339-004chr12:
24226311-24226311
CTintronicDe novo--Yuen2017 G
SOX5     2-1299-003chr12:
24107637-24107637
CTintronicDe novo--Yuen2017 G
SOX5     AU005213chr12:
24425135-24425135
GAintronicDe novo--Yuen2017 G
SOX5     AU4365302chr12:
23902548-23902548
TGintronicDe novo--Yuen2017 G
SOX5     133339chr12:
23687394-23687394
GTexonicnonsynonymous SNVNM_178010
NM_001261415
NM_006940
NM_001261414
NM_152989
c.C893A
c.C2021A
c.C2051A
c.C1688A
c.C2012A
p.A298D
p.A674D
p.A684D
p.A563D
p.A671D
22.1-Woodbury-Smith2022 E
SOX5     1-0389-004chr12:
24349318-24349318
CTintronicDe novo--Yuen2017 G
SOX5     1-0579-003chr12:
23838572-23838577
CAAAAACAAAAintronicDe novo--Yuen2017 G
SOX5     2-0299-005chr12:
23711832-23711832
CTintronicDe novo--Yuen2017 G
SOX5     7-0102-003chr12:
24481453-24481453
TAintronicDe novo--Yuen2017 G
SOX5     AU007503chr12:
24573280-24573280
GAintronicDe novo--Yuen2017 G
SOX5     AU0780301chr12:
24685595-24685595
GCintronicDe novo--Yuen2017 G
SOX5     1-0377-003chr12:
24431164-24431164
TCintronicDe novo--Yuen2017 G
SOX5     1-0674-004chr12:
24162336-24162336
TCintronicDe novo--Yuen2017 G
SOX5     2-0081-003chr12:
23701481-23701481
AGintronicDe novo--Yuen2017 G
SOX5     1-0142-005chr12:
24696378-24696378
CTintronicDe novo--Yuen2017 G
SOX5     AU2123301chr12:
24284793-24284793
AGintronicDe novo--Yuen2017 G
SOX5     AU3125301chr12:
24049117-24049117
CGintronicDe novo--Yuen2017 G
SOX5     AU4150301chr12:
24617360-24617360
CTintronicDe novo--Yuen2017 G
SOX5     AU3907302chr12:
24675977-24675977
AGintronicDe novo--Yuen2017 G
SOX5     AU4234303chr12:
24308749-24308749
GAintronicDe novo--Yuen2017 G
SOX5     74-0075chr12:
24573280-24573280
GAintronicDe novo--Michaelson2012 G
SOX5     1-0203-003chr12:
24198069-24198069
ACintronicDe novo--Yuen2017 G
SOX5     2-1366-004chr12:
23701387-23701387
CTintronicDe novo--Yuen2017 G
SOX5     AU3853302chr12:
24170245-24170245
GAintronicDe novo--Yuen2017 G
SOX5     AU2458303chr12:
24706274-24706274
ATintronicDe novo--Yuen2017 G
SOX5     2-1337-003chr12:
24679312-24679312
GTintronicDe novo--Yuen2016 G
Yuen2017 G
SOX5     5-0054-003chr12:
24255604-24255604
TCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More