or
or
Exact

Results for "GRIA3"

Variant Events: 16

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GRIA3     AU4122301chrX:
122681563-122681574
AAGGAGAAGGAGAAGGAGAAGGAGGAGAAGGAGintergenicDe novo--Yuen2017 G
GRIA3     2-0270-003chrX:
122691477-122691480
CCCTCintergenicDe novo--Yuen2017 G
GRIA3     2-1279-003chrX:
122732772-122732791
CAGAGAGAGAGAGAGAGAGACAGAGAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
GRIA3     AU3777302chrX:
122349841-122349841
GAintronicDe novo--Yuen2017 G
GRIA3     AU4027306chrX:
122590713-122590713
CTintronicDe novo--Yuen2017 G
GRIA3     2-1721-003chrX:
122712954-122712961
GAAAAAAAGAAAAAAintergenicDe novo--Yuen2017 G
GRIA3     AU1987304chrX:
122520442-122520442
GAintronicDe novo--Yuen2017 G
GRIA3     UK25363chrX:
122460038-122460038
GCexonicUnknownnonsynonymous SNVNM_000828
NM_007325
c.G670C
c.G670C
p.E224Q
p.E224Q
16.07-D’Gama2015 T
GRIA3     AU3122301chrX:
122597519-122597534
GAAAGAAAGAAAGAAAGAintronicDe novo--Yuen2017 G
GRIA3     AU4054302chrX:
122549880-122549884
GCCTCGCCTCCTCintronicDe novo--Yuen2017 G
GRIA3     5-0065-003chrX:
122345724-122345724
CGintronicDe novo--Yuen2017 G
GRIA3     5-0087-003chrX:
122494704-122494715
TCTCACACACACTCintronicDe novo--Yuen2017 G
GRIA3     2-0142-003chrX:
122508503-122508503
CCTGTTintronicDe novo--Yuen2017 G
GRIA3     AU3680301chrX:
122494704-122494709
TCTCACTCintronicDe novo--Yuen2017 G
GRIA3     Mahjani2021:76chrX:
122561908-122561908
TCexonicnonsynonymous SNVNM_000828
NM_007325
c.T1994C
c.T1994C
p.I665T
p.I665T
21.9-Mahjani2021 E
GRIA3     2-1383-003chrX:
122664905-122664906
ATAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More