or
or
Exact

Results for "Stessman2017"

Variant Events: 732

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SYNGAP1     08C77304chr6:
33411384-33411384
CTexonicUnknownnonsynonymous SNVNM_006772c.C3055Tp.R1019C16.893.303E-5Stessman2017 T
SIN3A     08C77304chr15:
75688662-75688662
GAexonicInheritednonsynonymous SNVNM_001145357
NM_001145358
NM_015477
c.C2030T
c.C2030T
c.C2030T
p.A677V
p.A677V
p.A677V
36.0-Stessman2017 T
AGAP2     08C73792chr12:
58121143-58121143
CGexonicUnknownnonsynonymous SNVNM_014770
NM_001122772
c.G2012C
c.G3080C
p.R671P
p.R1027P
23.0-Stessman2017 T
PARD3B     08C74095chr2:
206058041-206058041
CTexonicUnknownnonsynonymous SNVNM_152526
NM_001302769
NM_057177
NM_205863
c.C1951T
c.C2137T
c.C2137T
c.C2137T
p.L651F
p.L713F
p.L713F
p.L713F
22.1-Stessman2017 T
RELN     09C81884chr7:
103155785-103155785
CTexonicDe novononsynonymous SNVNM_005045
NM_173054
c.G7966A
c.G7966A
p.D2656N
p.D2656N
34.0-Stessman2017 T
Stessman2017 T
SETD5     09C82351chr3:
9506330-9506330
CTexonicUnknownnonsynonymous SNVNM_001080517
NM_001292043
c.C2698T
c.C2404T
p.R900C
p.R802C
28.52.484E-5Stessman2017 T
RIMBP2     09C80376chr12:
130912840-130912840
GAexonicUnknownnonsynonymous SNVNM_015347c.C2245Tp.R749W21.61.653E-5Stessman2017 T
CHD2     09C80382chr15:
93521585-93521585
GAexonicDe novononsynonymous SNVNM_001271c.G2699Ap.R900Q36.0-Stessman2017 T
Stessman2017 T
SMARCC2     09C82996chr12:
56575360-56575360
GAexonicPaternalstopgainNM_001130420
NM_003075
NM_139067
c.C862T
c.C862T
c.C862T
p.R288X
p.R288X
p.R288X
34.0-Stessman2017 T
SPAST     09C88948chr2:
32362027-32362027
AGexonicUnknownnonsynonymous SNVNM_199436
NM_014946
c.A1307G
c.A1403G
p.E436G
p.E468G
26.6-Stessman2017 T
SETD5     09C82352chr3:
9506330-9506330
CTexonicUnknownnonsynonymous SNVNM_001080517
NM_001292043
c.C2698T
c.C2404T
p.R900C
p.R802C
28.52.484E-5Stessman2017 T
PIK3CA     09C82723chr3:
178928068-178928068
CTexonicUnknownnonsynonymous SNVNM_006218c.C1346Tp.P449L28.6-Stessman2017 T
MED13L     09C91528chr12:
116434859-116434859
CAexonicDe novostopgainNM_015335c.G2746Tp.E916X43.0-Stessman2017 T
Stessman2017 T
RIMS1     09C95446chr6:
73110360-73110360
CGexonicUnknownnonsynonymous SNVNM_001168411
NM_001168408
NM_001168409
NM_001168410
NM_001168407
NM_014989
c.C604G
c.C2398G
c.C2227G
c.C2425G
c.C2983G
c.C5023G
p.R202G
p.R800G
p.R743G
p.R809G
p.R995G
p.R1675G
18.518.287E-6Stessman2017 T
ARID1B     09C90171chr6:
157522599-157522599
GAexonicUnknownnonsynonymous SNVNM_017519
NM_020732
c.G4832A
c.G4871A
p.R1611Q
p.R1624Q
18.981.878E-5Stessman2017 T
KMT2C     09C90854chr7:
151868351-151868351
GAexonicInheritedstopgainNM_170606c.C9451Tp.Q3151X51.0-Stessman2017 T
ANK2     09C95600chr4:
114177072-114177072
CTexonicUnknownnonsynonymous SNVNM_001148
NM_020977
NM_001127493
c.C1172T
c.C1172T
c.C1109T
p.P391L
p.P391L
p.P370L
22.48.267E-6Stessman2017 T
TRIP12     AU002403chr2:
230632431-230632431
GAexonicDe novostopgainNM_001284216
NM_001284215
NM_004238
NM_001284214
c.C5008T
c.C5917T
c.C5818T
c.C5962T
p.R1670X
p.R1973X
p.R1940X
p.R1988X
46.0-Stessman2017 T
Stessman2017 T
RIMS1     09C95447chr6:
73110360-73110360
CGexonicUnknownnonsynonymous SNVNM_001168411
NM_001168408
NM_001168409
NM_001168410
NM_001168407
NM_014989
c.C604G
c.C2398G
c.C2227G
c.C2425G
c.C2983G
c.C5023G
p.R202G
p.R800G
p.R743G
p.R809G
p.R995G
p.R1675G
18.518.287E-6Stessman2017 T
KMT2A     09C95599chr11:
118347554-118347554
GCexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.G3191C
c.G3191C
p.R1064P
p.R1064P
21.3-Stessman2017 T
PTK7     AU005303chr6:
43096771-43096771
GTexonicUnknownnonsynonymous SNVNM_001270398
NM_002821
NM_152880
NM_152881
NM_152882
c.G160T
c.G136T
c.G136T
c.G136T
c.G136T
p.G54W
p.G46W
p.G46W
p.G46W
p.G46W
27.1-Stessman2017 T
DOCK8     M08458chr9:
339101-339101
TCsplicingDe novosplicing25.2-Stessman2017 T
KMT2C     AU009503chr7:
151891590-151891590
CTexonicUnknownnonsynonymous SNVNM_170606c.G4442Ap.R1481Q24.81.648E-5Stessman2017 T
CUL7     AU002804chr6:
43018087-43018087
AGexonicUnknownnonsynonymous SNVNM_001168370
NM_014780
c.T1535C
c.T1283C
p.L512P
p.L428P
24.1-Stessman2017 T
UNC80     AU005213chr2:
210791693-210791693
GAexonicUnknownnonsynonymous SNVNM_032504
NM_182587
c.G5591A
c.G5576A
p.R1864Q
p.R1859Q
29.54.406E-5Stessman2017 T
CHD2     AU015203chr15:
93567810-93567810
CTexonicUnknownnonsynonymous SNVNM_001271c.C5362Tp.R1788C20.72.484E-5Stessman2017 T
NAV2     AU016403chr11:
19961215-19961215
CTexonicUnknownnonsynonymous SNVNM_001111018
NM_145117
NM_182964
NM_001244963
c.C1850T
c.C2042T
c.C2042T
c.C2111T
p.T617M
p.T681M
p.T681M
p.T704M
19.085.001E-5Stessman2017 T
NBEA     AU011604chr13:
35730288-35730288
CTexonicUnknownnonsynonymous SNVNM_015678c.C2596Tp.R866C25.11.628E-5Stessman2017 T
SETD5     AU011704chr3:
9483874-9483874
GAexonicPaternalnonsynonymous SNVNM_001080517
NM_001292043
c.G1022A
c.G728A
p.R341H
p.R243H
34.08.54E-6Stessman2017 T
PLXNA3     AU018803chrX:
153690630-153690630
CTexonicUnknownnonsynonymous SNVNM_017514c.C1297Tp.R433C22.53.703E-5Stessman2017 T
PASK     AU019303chr2:
242051710-242051711
AAAAAexonicInheritedframeshift insertionNM_001252119
NM_001252122
NM_015148
NM_001252120
c.3497dupT
c.3371dupT
c.3476dupT
c.3476dupT
p.F1166fs
p.F1124fs
p.F1159fs
p.F1159fs
--Stessman2017 T
HECTD1     AU016504chr14:
31618126-31618126
GAexonicInheritednonsynonymous SNVNM_015382c.C2396Tp.S799L35.01.658E-5Stessman2017 T
SPAST     AU018604chr2:
32314614-32314614
CTexonicUnknownnonsynonymous SNVNM_014946
NM_199436
c.C526T
c.C526T
p.R176C
p.R176C
26.16.644E-5Stessman2017 T
AGAP2     AU024104chr12:
58128130-58128130
CTexonicInheritednonsynonymous SNVNM_001122772
NM_014770
c.G1373A
c.G365A
p.R458Q
p.R122Q
35.04.119E-5Stessman2017 T
CUL7     AU024204chr6:
43010580-43010580
GAexonicUnknownnonsynonymous SNVNM_001168370
NM_014780
c.C3857T
c.C3605T
p.A1286V
p.A1202V
26.01.738E-5Stessman2017 T
GLI2     AU021503chr2:
121736022-121736022
GAexonicUnknownnonsynonymous SNVNM_005270c.G1381Ap.E461K20.8-Stessman2017 T
MYH9     AU022704chr22:
36701114-36701114
CTexonicInheritednonsynonymous SNVNM_002473c.G2194Ap.G732S35.0-Stessman2017 T
VCP     AU030504chr9:
35060803-35060803
CAexonicUnknownnonsynonymous SNVNM_007126c.G1477Tp.V493F25.5-Stessman2017 T
GRIN2B     AU030703chr12:
14018857-14018857
CAexonicUnknownnonsynonymous SNVNM_000834c.G286Tp.G96W24.5-Stessman2017 T
SCN2A     AU024703chr2:
166246020-166246020
CTexonicUnknownnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C5704T
c.C5704T
c.C5704T
p.R1902C
p.R1902C
p.R1902C
15.374.128E-5Stessman2017 T
CDC45     AU025506chr22:
19504369-19504369
CTexonicInheritednonsynonymous SNVNM_001178011
NM_003504
NM_001178010
c.C1451T
c.C1589T
c.C1685T
p.A484V
p.A530V
p.A562V
34.0-Stessman2017 T
HECTD1     AU031104chr14:
31617938-31617944
TTTTTTCTTTTTTTCexonicInheritedframeshift insertionNM_015382c.2485dupAp.T829fs--Stessman2017 T
CHD8     AU0316301chr14:
21868157-21868158
TAAexonicDe novoframeshift deletionNM_001170629
NM_020920
c.4800delA
c.3963delA
p.L1600fs
p.L1321fs
--Stessman2017 T
Stessman2017 T
NAA15     AU031003chr4:
140264106-140264108
ACAAexonicDe novoframeshift deletionNM_057175c.530_531delp.T177fs--Stessman2017 T
Stessman2017 T
SRCAP       AU031104chr16:
30750482-30750482
CTexonicUnknownstopgainNM_006662c.C9121Tp.R3041X47.0-Stessman2017 T
NEMF     AU038004chr14:
50251830-50251830
CAexonicUnknownnonsynonymous SNVNM_001301732
NM_004713
c.G2990T
c.G3053T
p.G997V
p.G1018V
22.4-Stessman2017 T
PHF7     AU050703chr3:
52457103-52457106
CCAGCCACsplicingInheritedsplicing16.91-Stessman2017 T
MECP2     AU034904chrX:
153295832-153295832
CAexonicInheritedstopgainNM_001110792
NM_004992
NM_001316337
c.G1483T
c.G1447T
c.G1168T
p.E495X
p.E483X
p.E390X
37.0-Stessman2017 T
DLGAP1     AU035604chr18:
3499254-3499254
GCexonicUnknownnonsynonymous SNVNM_001003809
NM_001242762
NM_001242764
NM_001242763
NM_001242766
NM_001308390
NM_004746
c.C1957G
c.C1915G
c.C1981G
c.C2029G
c.C1987G
c.C2011G
c.C2863G
p.R653G
p.R639G
p.R661G
p.R677G
p.R663G
p.R671G
p.R955G
23.7-Stessman2017 T
ARID1B     AU053503chr6:
157521885-157521885
GTexonicUnknownnonsynonymous SNVNM_017519
NM_020732
c.G4118T
c.G4157T
p.R1373L
p.R1386L
18.25-Stessman2017 T
PASK     AU054103chr2:
242051688-242051692
TCGATCexonicPaternalframeshift substitutionNM_001252119
NM_001252122
NM_015148
NM_001252120
c.3517_3521G
c.3391_3395G
c.3496_3500G
c.3496_3500G
N/A
N/A
N/A
N/A
--Stessman2017 T
SIN3A     AU052103chr15:
75687044-75687044
CTexonicUnknownnonsynonymous SNVNM_001145357
NM_001145358
NM_015477
c.G2254A
c.G2254A
c.G2254A
p.E752K
p.E752K
p.E752K
37.0-Stessman2017 T
RELN     AU0531302chr7:
103207069-103207069
GAexonicDe novostopgainNM_005045
NM_173054
c.C4726T
c.C4726T
p.R1576X
p.R1576X
45.0-Stessman2017 T
Stessman2017 T
IQGAP3     AU059903chr1:
156534435-156534435
GAexonicUnknownnonsynonymous SNVNM_178229c.C409Tp.R137W22.95.765E-5Stessman2017 T
NRXN1     AU061104chr2:
50755770-50755772
ACAAexonicInheritedframeshift deletionNM_004801
NM_001135659
c.2365_2366del
c.2485_2486del
p.C789fs
p.C829fs
--Stessman2017 T
EPHB2     AU057904chr1:
23239013-23239013
ATexonicUnknownnonsynonymous SNVNM_001309192
NM_001309193
NM_004442
NM_017449
c.A2599T
c.A2773T
c.A2776T
c.A2773T
p.I867F
p.I925F
p.I926F
p.I925F
26.7-Stessman2017 T
WAC     AU057904chr10:
28878776-28878776
GAexonicUnknownnonsynonymous SNVNM_016628
NM_100264
NM_100486
c.G493A
c.G358A
c.G493A
p.E165K
p.E120K
p.E165K
36.0-Stessman2017 T
PTPN11     AU066404chr12:
112926888-112926888
GAexonicUnknownnonsynonymous SNVNM_002834c.G1508Ap.G503E34.0-Stessman2017 T
SHANK2     AU071703chr11:
70803515-70803515
CTexonicUnknownunknown24.64.601E-5Stessman2017 T
FAM8A1     AU062003chr6:
17600766-17600779
CCCCCAGGCCGAACCCCCCAGGCTTAACexonicInheritednonframeshift substitutionNM_016255c.135_136TTN/A--Stessman2017 T
LAMC3     AU062203chr9:
133927895-133927895
CTexonicPaternalstopgainNM_006059c.C1648Tp.Q550X37.0-Stessman2017 T
CDC42BPB     AU079605chr14:
103442069-103442073
TTTCTTexonicInheritedframeshift deletionNM_006035c.1455_1458delp.K485fs--Stessman2017 T
SVIL     AU080103 Complex Event; expand row to view variants  Maternalstopgain, nonsynonymous SNVNM_003174
NM_021738
NM_003174
NM_021738
c.G1537A
c.G2815A
c.G1537T
c.G2815T
p.E513K
p.E939K
p.E513X
p.E939X
45.08.237E-5Stessman2017 T
Stessman2017 T
KATNAL2     AU071803chr18:
44595655-44595655
GAsplicingMaternalsplicing20.5-Stessman2017 T
MYT1L     AU074503chr2:
1796181-1796185
TCAATTexonicUnknownframeshift deletionNM_001303052
NM_015025
c.3328_3331del
c.3322_3325del
p.I1110fs
p.I1108fs
--Stessman2017 T
HDAC9     AU081104chr7:
18975476-18975476
CTexonicUnknownnonsynonymous SNVNM_058176
NM_178425
NM_178423
c.C2839T
c.C2848T
c.C2839T
p.R947C
p.R950C
p.R947C
26.68.283E-6Stessman2017 T
DHX9     AU082104chr1:
182852662-182852662
CTexonicUnknownnonsynonymous SNVNM_001357c.C3152Tp.T1051I27.2-Stessman2017 T
DLG2     AU080203chr11:
83195273-83195275
TGTTintronicMaternal--Stessman2017 T
ALDH5A1     AU080403chr6:
24533890-24533890
GAexonicPaternalnonsynonymous SNVNM_001080
NM_170740
c.G1558A
c.G1597A
p.G520S
p.G533S
35.0-Stessman2017 T
AGO4     AU083003chr1:
36306888-36306888
GAexonicPaternalnonsynonymous SNVNM_017629c.G1847Ap.R616Q36.08.245E-6Stessman2017 T
CACNA2D3     AU0863301chr3:
54925398-54925398
GAexonicUnknownnonsynonymous SNVNM_018398c.G2167Ap.V723M23.71.658E-5Stessman2017 T
AHNAK     AU083003chr11:
62284553-62284553
CTexonicUnknownnonsynonymous SNVNM_001620c.G17336Ap.R5779H18.319.084E-5Stessman2017 T
ZBTB45     AU083003chr19:
59025465-59025465
GAexonicUnknownnonsynonymous SNVNM_001316978
NM_001316979
NM_001316980
NM_001316981
NM_001316982
NM_032792
c.C1492T
c.C1492T
c.C1492T
c.C1492T
c.C1492T
c.C1492T
p.R498C
p.R498C
p.R498C
p.R498C
p.R498C
p.R498C
19.1-Stessman2017 T
SCN2A     AU0918301chr2:
166229814-166229815
CTTexonicDe novoframeshift deletionNM_001040143
NM_001040142
NM_021007
c.3929delC
c.3929delC
c.3929delC
p.A1310fs
p.A1310fs
p.A1310fs
--Stessman2017 T
Stessman2017 T
NAV2     AU0922301chr11:
20065731-20065731
CTexonicUnknownnonsynonymous SNVNM_001111019
NM_001111018
NM_145117
NM_182964
NM_001244963
c.C370T
c.C2920T
c.C3112T
c.C3112T
c.C3181T
p.R124W
p.R974W
p.R1038W
p.R1038W
p.R1061W
20.62.474E-5Stessman2017 T
CSMD1     AU0864301chr8:
2954369-2954369
AGsplicingInheritedsplicing22.5-Stessman2017 T
RELN     AU0903301chr7:
103163929-103163929
GAexonicDe novostopgainNM_005045
NM_173054
c.C7399T
c.C7399T
p.Q2467X
p.Q2467X
49.0-Stessman2017 T
Stessman2017 T
CTTNBP2     AU1067302chr7:
117501328-117501328
GAexonicUnknownnonsynonymous SNVNM_033427c.C124Tp.R42W23.61.0E-4Stessman2017 T
DLGAP1     AU1078301chr18:
3874153-3874153
CTsplicingInheritedsplicing15.7-Stessman2017 T
ERBIN     AU0959302chr5:
65339997-65339997
CAexonicPaternalstopgainNM_001006600
NM_001253697
NM_001253698
NM_001253699
NM_001253701
NM_018695
c.C1461A
c.C1461A
c.C1461A
c.C1461A
c.C1461A
c.C1461A
p.Y487X
p.Y487X
p.Y487X
p.Y487X
p.Y487X
p.Y487X
36.0-Stessman2017 T
MKI67     M21670chr10:
129899612-129899614
TGTTexonicMaternalframeshift deletionNM_001145966
NM_002417
c.8533_8534del
c.9613_9614del
p.T2845fs
p.T3205fs
--Stessman2017 T
KMT2C     AU1067302chr7:
151856028-151856028
GAexonicUnknownnonsynonymous SNVNM_170606c.C11590Tp.R3864C19.711.647E-5Stessman2017 T
GLI2     AU1107301chr2:
121726332-121726332
GAexonicInheritednonsynonymous SNVNM_005270c.G686Ap.R229H35.01.659E-5Stessman2017 T
ANP32A     AU1196301chr15:
69075303-69075303
CGexonicUnknownnonsynonymous SNVNM_006305c.G616Cp.E206Q15.294.487E-5Stessman2017 T
MKI67     M23639chr10:
129913651-129913652
CAAexonicPaternalframeshift deletionNM_002417c.1021delGp.E341fs--Stessman2017 T
KAT2B     AU1087301chr3:
20142791-20142793
TTTTexonicInheritedframeshift deletionNM_003884c.683_684delp.F228fs--Stessman2017 T
CDC42BPB     AU1097302chr14:
103449962-103449962
CTexonicUnknownnonsynonymous SNVNM_006035c.G822Ap.M274I32.08.27E-6Stessman2017 T
SCN1A     AU1209302chr2:
166901612-166901612
GAexonicUnknownnonsynonymous SNVNM_001165963
NM_001165964
NM_006920
NM_001202435
c.C1603T
c.C1603T
c.C1603T
c.C1603T
p.R535C
p.R535C
p.R535C
p.R535C
29.93.295E-5Stessman2017 T
PTK7     AU1220301chr6:
43107257-43107257
CTexonicUnknownnonsynonymous SNVNM_001270398
NM_002821
NM_152882
c.C1636T
c.C1612T
c.C1612T
p.R546W
p.R538W
p.R538W
19.84-Stessman2017 T
LHX1     AU1196301chr17:
35298026-35298026
GCexonicMaternalnonsynonymous SNVNM_005568c.G517Cp.D173H33.0-Stessman2017 T
STXBP5     AU1207301chr6:
147684764-147684764
CTexonicUnknownnonsynonymous SNVNM_139244
NM_001127715
c.C2731T
c.C2839T
p.R911C
p.R947C
19.061.655E-5Stessman2017 T
CACNA2D3     AU1271303chr3:
54676264-54676264
GAexonicMaternalnonsynonymous SNVNM_018398c.G1163Ap.R388Q34.01.09E-5Stessman2017 T
ANK2     AU1272301chr4:
114275580-114275580
CTexonicUnknownnonsynonymous SNVNM_001148c.C5806Tp.R1936C17.391.649E-5Stessman2017 T
ASXL3     AU1244301chr18:
31318450-31318450
GAsplicingInheritedsplicing15.16-Stessman2017 T
AGAP2     AU1254301chr12:
58127926-58127926
CTexonicInheritednonsynonymous SNVNM_001122772
NM_014770
c.G1432A
c.G424A
p.V478I
p.V142I
35.04.172E-5Stessman2017 T
CTNND2     AU1352302chr5:
11111014-11111014
CTexonicPaternalnonsynonymous SNVNM_001288716
NM_001288715
NM_001288717
NM_001332
c.G1408A
c.G2146A
c.G1120A
c.G2419A
p.G470R
p.G716R
p.G374R
p.G807R
32.0-Stessman2017 T
RANBP2     AU1374302chr2:
109388202-109388202
TAexonicUnknownnonsynonymous SNVNM_006267c.T7895Ap.V2632D23.71.652E-5Stessman2017 T
ARHGAP32     AU1339302chr11:
128839688-128839688
CTexonicUnknownnonsynonymous SNVNM_014715
NM_001142685
c.G4331A
c.G5378A
p.R1444H
p.R1793H
21.22.471E-5Stessman2017 T
DSCAM     AU1350302chr21:
41414303-41414303
CTexonicMaternalnonsynonymous SNVNM_001271534
NM_001389
c.G5681A
c.G5681A
p.R1894Q
p.R1894Q
35.0-Stessman2017 T
KMT2A     AU1391302chr11:
118392020-118392020
GAexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.G11531A
c.G11522A
p.R3844Q
p.R3841Q
26.8-Stessman2017 T
NAV2     AU1400301chr11:
19970374-19970374
CAexonicUnknownnonsynonymous SNVNM_001111018
NM_145117
NM_182964
NM_001244963
c.C2201A
c.C2393A
c.C2393A
c.C2462A
p.P734H
p.P798H
p.P798H
p.P821H
27.2-Stessman2017 T
LAMC3     AU1377302chr9:
133914319-133914319
GAexonicPaternalnonsynonymous SNVNM_006059c.G1045Ap.G349S35.0-Stessman2017 T
LAMC3     AU1390302chr9:
133914592-133914592
CTexonicUnknownnonsynonymous SNVNM_006059c.C1240Tp.R414C19.322.493E-5Stessman2017 T
DNAJC6     AU1453302chr1:
65849885-65849887
GCGGCGCGexonicInheritedframeshift insertionNM_001256864
NM_014787
NM_001256865
c.678_679insCG
c.507_508insCG
c.468_469insCG
p.A226fs
p.A169fs
p.A156fs
--Stessman2017 T
DHX9     AU1459301chr1:
182822497-182822497
CTexonicDe novostopgainNM_001357c.C421Tp.R141X21.3-Stessman2017 T
Stessman2017 T
UNC80     AU1423304chr2:
210810654-210810654
GAexonicUnknownnonsynonymous SNVNM_032504
NM_182587
c.G7075A
c.G7060A
p.E2359K
p.E2354K
22.1-Stessman2017 T
CTTNBP2     AU1446301chr7:
117386142-117386142
ACexonicMaternalstopgainNM_033427c.T3360Gp.Y1120X37.0-Stessman2017 T
CDC42BPB     AU1522303chr14:
103442313-103442313
GAexonicUnknownnonsynonymous SNVNM_006035c.C1294Tp.R432W22.6-Stessman2017 T
CSMD1     AU1573301chr8:
2857552-2857552
GAexonicUnknownnonsynonymous SNVNM_033225c.C8131Tp.R2711W15.95.798E-5Stessman2017 T
DIP2A     AU1497302chr21:
47971556-47971556
CAexonicUnknownnonsynonymous SNVNM_001146116
NM_015151
c.C2837A
c.C2849A
p.P946Q
p.P950Q
26.9-Stessman2017 T
NEMF     AU1499301chr14:
50312961-50312961
CTexonicMaternalnonsynonymous SNVNM_001301732
NM_004713
c.G254A
c.G254A
p.R85Q
p.R85Q
36.05.769E-5Stessman2017 T
ARHGAP32     AU1699302chr11:
128846506-128846506
GAexonicUnknownnonsynonymous SNVNM_014715
NM_001142685
c.C1057T
c.C2104T
p.R353C
p.R702C
25.41.648E-5Stessman2017 T
TRIO     AU1835302chr5:
14481662-14481663
GTTexonicMaternalframeshift deletionNM_007118c.6400delGp.V2134fs--Stessman2017 T
PTK7     AU1576302chr6:
43099815-43099815
CTexonicUnknownnonsynonymous SNVNM_001270398
NM_002821
NM_152880
NM_152881
NM_152882
c.C898T
c.C874T
c.C874T
c.C874T
c.C874T
p.R300W
p.R292W
p.R292W
p.R292W
p.R292W
25.14.136E-5Stessman2017 T
PTK7     AU1685301chr6:
43098344-43098349
CCCCCGCCCCGexonicInheritedframeshift deletionNM_001270398
NM_002821
NM_152880
NM_152881
NM_152882
c.781delC
c.757delC
c.757delC
c.757delC
c.757delC
p.P261fs
p.P253fs
p.P253fs
p.P253fs
p.P253fs
--Stessman2017 T
KMT2C     AU1885302chr7:
151949146-151949147
GTTexonicInheritedframeshift deletionNM_170606c.1499delCp.T500fs--Stessman2017 T
AGO4     AU1941302chr1:
36292396-36292396
CTexonicPaternalstopgainNM_017629c.C808Tp.R270X38.0-Stessman2017 T
CAPRIN1     AU1840305chr11:
34119293-34119293
CTexonicUnknownnonsynonymous SNVNM_005898
NM_203364
c.C2050T
c.C2050T
p.R684W
p.R684W
17.24-Stessman2017 T
RELN     AU1885302chr7:
103207068-103207068
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G4727A
c.G4727A
p.R1576Q
p.R1576Q
23.4-Stessman2017 T
SMARCC2     AU2554301chr12:
56575360-56575360
GAexonicPaternalstopgainNM_001130420
NM_003075
NM_139067
c.C862T
c.C862T
c.C862T
p.R288X
p.R288X
p.R288X
34.0-Stessman2017 T
TNRC6B     AU2689306chr22:
40669453-40669459
GGGGGGAGGGGGGGAexonicDe novoframeshift insertionNM_015088
NM_001162501
NM_001024843
c.2831dupG
c.2990dupG
c.749dupG
p.W944fs
p.W997fs
p.W250fs
--Stessman2017 T
Stessman2017 T
NISCH     AU2004302chr3:
52505847-52505847
GAexonicMaternalnonsynonymous SNVNM_001276293
NM_001276294
NM_007184
c.G427A
c.G427A
c.G427A
p.A143T
p.A143T
p.A143T
34.0-Stessman2017 T
MAP3K1     M20294chr5:
56167804-56167805
ACAACexonicMaternalframeshift insertionNM_005921c.1369dupAp.L456fs--Stessman2017 T
WDFY3     AU2182302chr4:
85708747-85708747
CTexonicInheritedstopgainNM_014991c.G3789Ap.W1263X46.0-Stessman2017 T
AHNAK     M17634chr11:
62288309-62288310
TTTexonicMaternalframeshift deletionNM_001620c.13579delAp.N4527fs--Stessman2017 T
SRCAP       AU3142302chr16:
30745227-30745231
ACGGAACGGACGGAexonicInheritedframeshift insertionNM_006662c.6511_6512insCGGAp.T2171fs--Stessman2017 T
AHNAK     M20684chr11:
62284525-62284531
CTCTCTTCTCTTexonicMaternalframeshift deletionNM_001620c.17363_17364delp.E5788fs--Stessman2017 T
ADGRL2     101443-100chr1:
82266199-82266199
TAsplicingInheritedsplicing--Stessman2017 T
AHNAK     M20567chr11:
62285077-62285079
AGAAexonicMaternalframeshift deletionNM_001620c.16810_16811delp.S5604fs--Stessman2017 T
CHD7     AU2835301chr8:
61765088-61765088
CTexonicUnknownnonsynonymous SNVNM_017780c.C5926Tp.R1976C27.4-Stessman2017 T
PARD3B     M20709chr2:
206165462-206165463
TAGsplicingPaternalsplicing--Stessman2017 T
TRIO     AU2835301chr5:
14363928-14363928
CTexonicUnknownnonsynonymous SNVNM_007118c.C2479Tp.R827C16.83-Stessman2017 T
PARD3B     M14996chr2:
205978217-205978219
ATAAexonicPaternalframeshift deletionNM_001302769
NM_057177
NM_152526
NM_205863
c.597_598del
c.597_598del
c.597_598del
c.597_598del
p.D199fs
p.D199fs
p.D199fs
p.D199fs
--Stessman2017 T
DHX9     109056-200chr1:
182841496-182841496
CTexonicUnknownnonsynonymous SNVNM_001357c.C1582Tp.R528C19.488.295E-6Stessman2017 T
KMT2E     109580-100chr7:
104752482-104752482
CTexonicInheritedstopgainNM_018682
NM_182931
c.C4279T
c.C4279T
p.Q1427X
p.Q1427X
57.0-Stessman2017 T
SHANK2     108070-100chr11:
70803488-70803488
CGexonicUnknownunknown26.2-Stessman2017 T
MAP3K1     108990-100chr5:
56177585-56177585
GAexonicUnknownnonsynonymous SNVNM_005921c.G2558Ap.R853H23.31.0E-4Stessman2017 T
KATNAL2     AU059903chr18:
44589434-44589435
ACAexonicDe novoframeshift deletionNM_031303c.426delCp.D142fs-1.649E-5Stessman2017 T
ARID1B     AU0901302chr6:
157256598-157256598
AGsplicingDe novosplicing17.618.238E-6Stessman2017 T
UNC80     110198-100chr2:
210714270-210714270
CTexonicUnknownnonsynonymous SNVNM_032504
NM_182587
c.C3556T
c.C3541T
p.R1186C
p.R1181C
22.14.608E-5Stessman2017 T
DYRK1A     AU048204chr21:
38862503-38862503
CTexonicDe novostopgainNM_001396
NM_130436
NM_130438
NM_101395
c.C691T
c.C664T
c.C691T
c.C691T
p.R231X
p.R222X
p.R231X
p.R231X
50.0-Stessman2017 T
IQGAP3     B6U2X Complex Event; expand row to view variants  Unknownnonsynonymous SNVNM_178229
NM_178229
c.G125T
c.G125A
p.R42L
p.R42H
32.01.758E-5Stessman2017 T
Stessman2017 T
NCKAP1     B8C8Dchr2:
183841656-183841656
ATexonicInheritednonsynonymous SNVNM_013436
NM_205842
c.T1447A
c.T1465A
p.F483I
p.F489I
34.0-Stessman2017 T
WDFY3     A4F4Tchr4:
85654657-85654657
CTexonicUnknownnonsynonymous SNVNM_014991c.G7099Ap.D2367N26.22.472E-5Stessman2017 T
MYH9     A8Z8Mchr22:
36685240-36685240
CTexonicInheritednonsynonymous SNVNM_002473c.G4448Ap.R1483Q36.08.307E-6Stessman2017 T
NAV2     C5V2Nchr11:
20065608-20065608
GAexonicInheritednonsynonymous SNVNM_001111019
NM_001111018
NM_145117
NM_182964
NM_001244963
c.G247A
c.G2797A
c.G2989A
c.G2989A
c.G3058A
p.D83N
p.D933N
p.D997N
p.D997N
p.D1020N
31.0-Stessman2017 T
CSTF2T     D2M2Cchr10:
53457864-53457871
ATTAATGGGexonicInheritedframeshift deletionNM_015235c.1440_1446delp.P480fs--Stessman2017 T
NRXN1     B8Z4Fchr2:
50692579-50692579
CTsplicingInheritedsplicing22.5-Stessman2017 T
GRIN2B     B9M7Fchr12:
13828767-13828767
CTexonicUnknownnonsynonymous SNVNM_000834c.G1037Ap.G346E29.1-Stessman2017 T
GLI2     D3G5Achr2:
121736074-121736074
CTexonicUnknownnonsynonymous SNVNM_005270c.C1433Tp.T478M19.841.652E-5Stessman2017 T
RIMS1     D3P6Hchr6:
72892579-72892580
CCCCCexonicInheritedframeshift insertionNM_014989c.1406dupCp.P469fs--Stessman2017 T
DNAJC6     D2P3Nchr1:
65874429-65874429
AGexonicUnknownnonsynonymous SNVNM_001256864
NM_014787
NM_001256865
c.A2597G
c.A2426G
c.A2387G
p.E866G
p.E809G
p.E796G
28.3-Stessman2017 T
ANK3     D2P3Nchr10:
61868693-61868693
CAexonicUnknownnonsynonymous SNVNM_001149
NM_020987
NM_001204403
NM_001204404
c.G470T
c.G3068T
c.G3050T
c.G3071T
p.R157L
p.R1023L
p.R1017L
p.R1024L
28.7-Stessman2017 T
NAV2     E5B6Ychr11:
20122617-20122617
TCexonicUnknownnonsynonymous SNVNM_001111019
NM_001111018
NM_145117
NM_182964
NM_001244963
c.T3508C
c.T6124C
c.T6316C
c.T6325C
c.T6493C
p.Y1170H
p.Y2042H
p.Y2106H
p.Y2109H
p.Y2165H
28.71.0E-4Stessman2017 T
ARID1B     E5J5Mchr6:
157454333-157454333
GTexonicUnknownnonsynonymous SNVNM_017519
NM_020732
c.G2504T
c.G2543T
p.G835V
p.G848V
27.88.987E-6Stessman2017 T
SIN3A     D9S5Ychr15:
75676661-75676661
CGexonicInheritednonsynonymous SNVNM_001145357
NM_001145358
NM_015477
c.G3139C
c.G3139C
c.G3139C
p.E1047Q
p.E1047Q
p.E1047Q
35.0-Stessman2017 T
HECTD1     D9Y6Bchr14:
31638665-31638665
GAexonicUnknownnonsynonymous SNVNM_015382c.C1342Tp.R448W19.18-Stessman2017 T
ADCY9     E9L8Xchr16:
4165128-4165129
CCCexonicInheritedframeshift deletionNM_001116c.315delGp.L105fs--Stessman2017 T
PLXNB1     E9R8Hchr3:
48460711-48460711
ACexonicInheritednonsynonymous SNVNM_001130082
NM_002673
c.T2774G
c.T2774G
p.M925R
p.M925R
13.219.34E-6Stessman2017 T
WNT9A     E7C2Schr1:
228109385-228109385
CTexonicUnknownnonsynonymous SNVNM_003395c.G932Ap.R311H29.21.694E-5Stessman2017 T
AGAP2     E7G2Uchr12:
58126690-58126690
CAexonicUnknownnonsynonymous SNVNM_001122772
NM_014770
c.G1622T
c.G614T
p.R541L
p.R205L
27.71.648E-5Stessman2017 T
HUWE1     G5A3SchrX:
53565406-53565406
CTexonicUnknownnonsynonymous SNVNM_031407c.G11888Ap.R3963H17.0-Stessman2017 T
DLG2     G6U8Schr11:
83252891-83252891
CTexonicInheritednonsynonymous SNVNM_001142702
NM_001142700
NM_001206769
NM_001300983
NM_001364
NM_001142699
c.G82A
c.G1327A
c.G1753A
c.G1636A
c.G1636A
c.G1951A
p.D28N
p.D443N
p.D585N
p.D546N
p.D546N
p.D651N
35.01.713E-5Stessman2017 T
ADCY5     F2D5Vchr3:
123167215-123167222
CCCCCCCGCCCCCCCCGexonicUnknownframeshift insertionNM_183357c.178dupGp.A60fs-7.932E-5Stessman2017 T
PLXNB1     F8V5Ychr3:
48454004-48454004
CTexonicUnknownnonsynonymous SNVNM_001130082
NM_002673
c.G4880A
c.G4880A
p.R1627H
p.R1627H
25.88.314E-6Stessman2017 T
CUL7     H7E6Mchr6:
43020447-43020447
CTexonicMaternalnonsynonymous SNVNM_001168370
NM_014780
c.G236A
c.G80A
p.R79H
p.R27H
32.0-Stessman2017 T
MOV10     H7E6Mchr1:
113238813-113238814
CCAAexonicUnknownnonframeshift substitutionNM_001130079
NM_020963
NM_001286072
c.1823_1824AA
c.1823_1824AA
c.1655_1656AA
N/A
N/A
N/A
--Stessman2017 T
DLG4     G9A6Qchr17:
7097695-7097695
CTexonicInheritednonsynonymous SNVNM_001128827
NM_001365
c.G1412A
c.G1550A
p.R471Q
p.R517Q
35.02.042E-5Stessman2017 T
MYT1L     H5B6Cchr2:
1926586-1926586
CTexonicUnknownnonsynonymous SNVNM_001303052
NM_015025
c.G955A
c.G955A
p.D319N
p.D319N
26.9-Stessman2017 T
DIP2A     J3P5S Complex Event; expand row to view variants  Unknownnonsynonymous SNVNM_001146116
NM_015151
NM_001146116
NM_015151
c.G4591T
c.G4603T
c.G4591A
c.G4603A
p.V1531L
p.V1535L
p.V1531M
p.V1535M
26.48.256E-6Stessman2017 T
Stessman2017 T
CTTNBP2     J7S7Zchr7:
117365294-117365296
CACCexonicInheritedframeshift deletionNM_033427c.4071_4072delp.L1357fs--Stessman2017 T
RIMS1     H7P2Hchr6:
73100420-73100420
GAexonicInheritednonsynonymous SNVNM_001168411
NM_001168408
NM_001168409
NM_001168410
NM_001168407
NM_014989
c.G68A
c.G1862A
c.G1691A
c.G1889A
c.G2447A
c.G4487A
p.S23N
p.S621N
p.S564N
p.S630N
p.S816N
p.S1496N
32.08.294E-6Stessman2017 T
ANK3     J2Y7Xchr10:
61846455-61846455
CTexonicInheritednonsynonymous SNVNM_001149
NM_020987
NM_001204403
NM_001204404
c.G1130A
c.G3728A
c.G3710A
c.G3731A
p.R377H
p.R1243H
p.R1237H
p.R1244H
35.08.256E-6Stessman2017 T
DIP2A     M3Z4Qchr21:
47958398-47958398
CTexonicUnknownnonsynonymous SNVNM_001146115
NM_001146116
NM_015151
NM_206889
NM_206890
NM_206891
c.C1675T
c.C1792T
c.C1804T
c.C1804T
c.C1804T
c.C1804T
p.R559W
p.R598W
p.R602W
p.R602W
p.R602W
p.R602W
17.02-Stessman2017 T
UNC80     M5L6Achr2:
210808218-210808218
GAexonicInheritednonsynonymous SNVNM_032504
NM_182587
c.G6832A
c.G6817A
p.A2278T
p.A2273T
33.0-Stessman2017 T
SRCAP       L3C2Schr16:
30734420-30734421
TCCexonicInheritedframeshift deletionNM_006662c.4029delTp.N1343fs--Stessman2017 T
RELN     M2C4Jchr7:
103123375-103123375
GAexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.C10225T
c.C10225T
p.R3409C
p.R3409C
34.03.295E-5Stessman2017 T
CUL7     N9F2Nchr6:
43013344-43013344
CTexonicUnknownnonsynonymous SNVNM_001168370
NM_014780
c.G3095A
c.G2843A
p.R1032H
p.R948H
25.51.648E-5Stessman2017 T
ASH1L     P2S8Zchr1:
155448057-155448057
CAexonicUnknownnonsynonymous SNVNM_018489c.G4604Tp.R1535L16.658.237E-6Stessman2017 T
AGO4     M9A4Dchr1:
36306887-36306887
CTexonicUnknownnonsynonymous SNVNM_017629c.C1846Tp.R616W21.1-Stessman2017 T
DOCK8     N6A9Kchr9:
386340-386340
CTexonicUnknownnonsynonymous SNVNM_001193536
NM_203447
c.C2584T
c.C2788T
p.R862C
p.R930C
16.828.261E-6Stessman2017 T
NEMF     P9B3Schr14:
50280770-50280770
TCsplicingInheritedsplicing18.62-Stessman2017 T
ARID1B     Q6R5Cchr6:
157510782-157510782
CTexonicUnknownnonsynonymous SNVNM_017519
NM_020732
c.C3518T
c.C3557T
p.S1173L
p.S1186L
22.7-Stessman2017 T
IQGAP3     P3W4Nchr1:
156535883-156535883
TAexonicUnknownnonsynonymous SNVNM_178229c.A296Tp.H99L26.28.237E-6Stessman2017 T
CTTNBP2     P4N4Wchr7:
117358155-117358155
CAexonicUnknownnonsynonymous SNVNM_033427c.G4663Tp.D1555Y22.05.268E-5Stessman2017 T
SETBP1     R3L9Pchr18:
42533266-42533266
CTexonicUnknownnonsynonymous SNVNM_015559c.C3961Tp.R1321C18.292.508E-5Stessman2017 T
DOCK8     R8F8Zchr9:
428479-428479
CTexonicUnknownnonsynonymous SNVNM_001190458
NM_001193536
NM_203447
c.C4156T
c.C4252T
c.C4456T
p.R1386C
p.R1418C
p.R1486C
20.21.651E-5Stessman2017 T
ANK3     Q7E4Fchr10:
61959930-61959930
CTexonicInheritednonsynonymous SNVNM_001204404
NM_020987
NM_001204403
c.G1397A
c.G1448A
c.G1430A
p.R466Q
p.R483Q
p.R477Q
35.0-Stessman2017 T
UNC80     R3C2Bchr2:
210832237-210832237
CTexonicUnknownnonsynonymous SNVNM_032504
NM_182587
c.C7684T
c.C7669T
p.R2562C
p.R2557C
26.64.803E-5Stessman2017 T
PROX2     S8M8Zchr14:
75323607-75323607
GTexonicUnknownnonsynonymous SNVNM_001080408
NM_001243007
c.C824A
c.C1505A
p.A275E
p.A502E
33.08.281E-6Stessman2017 T
ADNP     211-5367-3chr20:
49508081-49508081
ATexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.T3170A
c.T3170A
c.T3170A
c.T3170A
p.L1057X
p.L1057X
p.L1057X
p.L1057X
45.0-Stessman2017 T
Stessman2017 T
ANK2     S9L7Kchr4:
114251568-114251568
GAexonicUnknownnonsynonymous SNVNM_001148
NM_020977
NM_001127493
c.G3067A
c.G3067A
c.G3040A
p.G1023R
p.G1023R
p.G1014R
25.48.257E-6Stessman2017 T
CHD2     215-13023-0303chr15:
93563256-93563256
CTexonicDe novostopgainNM_001271c.C4921Tp.Q1641X49.0-Stessman2017 T
Stessman2017 T
MED13L     S5K6Bchr12:
116401258-116401258
GAexonicUnknownnonsynonymous SNVNM_015335c.C6454Tp.R2152W22.2-Stessman2017 T
DSCAM     S7J3Dchr21:
41719645-41719645
GAexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.C1162T
c.C1162T
p.R388C
p.R388C
18.498.28E-6Stessman2017 T
RANBP2     T8W2Wchr2:
109345594-109345594
AGexonicInheritednonsynonymous SNVNM_006267c.A79Gp.M27V9.4151.861E-5Stessman2017 T
ANK3     T8W2Wchr10:
61843315-61843315
CTexonicUnknownnonsynonymous SNVNM_001149
NM_020987
NM_001204403
NM_001204404
c.G1537A
c.G4135A
c.G4117A
c.G4138A
p.G513R
p.G1379R
p.G1373R
p.G1380R
17.61.656E-5Stessman2017 T
CHD2     T3A5Lchr15:
93482851-93482851
CTexonicUnknownnonsynonymous SNVNM_001042572
NM_001271
c.C595T
c.C595T
p.R199C
p.R199C
25.12.471E-5Stessman2017 T
CHD8     220-9823-203chr14:
21876489-21876489
CTexonicUnknownnonsynonymous SNVNM_001170629
NM_020920
c.G2712A
c.G1875A
p.M904I
p.M625I
18.24-Stessman2017 T
CUL7     T7X5Jchr6:
43018878-43018878
GTexonicInheritedstopgainNM_001168370
NM_014780
c.C1313A
c.C1061A
p.S438X
p.S354X
36.0-Stessman2017 T
CHD8     211-5221-3chr14:
21865980-21865980
ATsplicingDe novosplicing15.92-Stessman2017 T
Stessman2017 T
GPRIN1     U4V8Tchr5:
176024859-176024863
CAAACCexonicInheritedframeshift deletionNM_052899c.1973_1976delp.C658fs--Stessman2017 T
CHD7     U5B9Hchr8:
61748841-61748841
CTexonicUnknownnonsynonymous SNVNM_017780c.C3988Tp.R1330W22.01.0E-4Stessman2017 T
CHD7     U3Q8Vchr8:
61655553-61655553
CTexonicUnknownnonsynonymous SNVNM_001316690
NM_017780
c.C1562T
c.C1562T
p.P521L
p.P521L
23.62.533E-5Stessman2017 T
STXBP5     U3V4Pchr6:
147680250-147680250
GAexonicInheritednonsynonymous SNVNM_139244
NM_001127715
c.G2228A
c.G2336A
p.R743Q
p.R779Q
36.08.286E-5Stessman2017 T
TCF4     V9Y8Echr18:
53017634-53017634
GAexonicInheritedstopgainNM_001243232
NM_001243233
NM_001306208
NM_001243231
NM_001243227
NM_001243230
NM_001306207
NM_001083962
NM_001243228
NM_003199
NM_001243226
c.C292T
c.C115T
c.C292T
c.C379T
c.C433T
c.C499T
c.C433T
c.C505T
c.C505T
c.C505T
c.C811T
p.Q98X
p.Q39X
p.Q98X
p.Q127X
p.Q145X
p.Q167X
p.Q145X
p.Q169X
p.Q169X
p.Q169X
p.Q271X
20.9-Stessman2017 T
RANBP2     W7R4Wchr2:
109398656-109398656
CTexonicUnknownnonsynonymous SNVNM_006267c.C8833Tp.R2945W17.96-Stessman2017 T
DIP2A     U5C5Lchr21:
47986571-47986571
CTexonicInheritedstopgainNM_001146116
NM_015151
c.C4426T
c.C4438T
p.R1476X
p.R1480X
45.01.653E-5Stessman2017 T
ADGRL2     U6G2Jchr1:
82435043-82435043
TCexonicUnknownnonsynonymous SNVNM_001297705
NM_001297706
NM_012302
NM_001297704
c.T2654C
c.T2654C
c.T2654C
c.T2654C
p.L885P
p.L885P
p.L885P
p.L885P
22.72.473E-5Stessman2017 T
CSMD1     Y6P6Jchr8:
2836280-2836280
CTexonicUnknownnonsynonymous SNVNM_033225c.G8420Ap.R2807H15.081.803E-5Stessman2017 T
DLGAP1     Y7H4Lchr18:
3534477-3534477
GAexonicUnknownnonsynonymous SNVNM_001003809
NM_001242762
NM_001242764
NM_001242765
NM_001242763
NM_001242766
NM_001308390
NM_001242761
NM_004746
c.C1288T
c.C1246T
c.C1312T
c.C1288T
c.C1360T
c.C1318T
c.C1342T
c.C2194T
c.C2194T
p.R430C
p.R416C
p.R438C
p.R430C
p.R454C
p.R440C
p.R448C
p.R732C
p.R732C
19.298.241E-6Stessman2017 T
ITPR1     X8G5Tchr3:
4693861-4693861
CTexonicUnknownnonsynonymous SNVNM_001099952
NM_001168272
NM_002222
c.C910T
c.C910T
c.C910T
p.R304C
p.R304C
p.R304C
19.23-Stessman2017 T
DIP2A     Y4R4Mchr21:
47971600-47971600
GAexonicInheritednonsynonymous SNVNM_001146116
NM_015151
c.G2881A
c.G2893A
p.A961T
p.A965T
34.02.503E-5Stessman2017 T
CHD2     Z2T2Mchr15:
93563464-93563464
GAexonicInheritednonsynonymous SNVNM_001271c.G5129Ap.R1710Q35.0-Stessman2017 T
UNC80     Z3D2Schr2:
210787062-210787062
CTexonicUnknownnonsynonymous SNVNM_032504
NM_182587
c.C5419T
c.C5404T
p.R1807C
p.R1802C
28.0-Stessman2017 T
IQSEC2     Y9P8UchrX:
53279669-53279669
CTexonicUnknownnonsynonymous SNVNM_001111125
NM_015075
c.G2089A
c.G1474A
p.E697K
p.E492K
19.69-Stessman2017 T
CDC45     Y9P9Schr22:
19502333-19502333
CTexonicInheritedstopgainNM_001178011
NM_003504
NM_001178010
c.C1141T
c.C1279T
c.C1375T
p.Q381X
p.Q427X
p.Q459X
39.0-Stessman2017 T
LZTR1     Z8R7Tchr22:
21351525-21351526
CCCCCexonicInheritedframeshift insertionNM_006767c.2412dupCp.S804fs--Stessman2017 T
NRXN1     217-14288-4090chr2:
50170867-50170868
GGGexonicDe novoframeshift deletionNM_138735
NM_004801
NM_001135659
c.995delC
c.4100delC
c.4310delC
p.P332fs
p.P1367fs
p.P1437fs
--Stessman2017 T
Stessman2017 T
LZTR1     Z9J9Fchr22:
21348845-21348846
AGCCsplicingInheritedsplicing--Stessman2017 T
GLI2     Z4A7Ychr2:
121554977-121554991
CCCGGGTAAAAAGGCCexonicInheritedframeshift deletionNM_005270c.82_95delp.P28fs--Stessman2017 T
PAX5     211-5583-3chr9:
37020769-37020776
CCCCCCCACCCCCCCCAexonicDe novoframeshift insertionNM_001280547
NM_001280548
NM_001280549
NM_001280550
NM_001280552
NM_001280553
NM_001280554
NM_001280555
NM_016734
c.76dupG
c.76dupG
c.76dupG
c.76dupG
c.76dupG
c.76dupG
c.76dupG
c.76dupG
c.76dupG
p.V26fs
p.V26fs
p.V26fs
p.V26fs
p.V26fs
p.V26fs
p.V26fs
p.V26fs
p.V26fs
-1.0E-4Stessman2017 T
Stessman2017 T
CUL7     Z7W4Jchr6:
43006211-43006211
CTsplicingInheritedsplicing19.54-Stessman2017 T
GRIN2B     150281chr12:
13906250-13906250
CTsplicingInheritedsplicing22.9-Stessman2017