or
or
Exact

Results for "Krumm2015"

Variant Events: 846

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
EPN1     11461.p1chr19:
56196973-56196973
CTexonicDe novononsynonymous SNVNM_001130072
NM_013333
NM_001130071
c.C440T
c.C440T
c.C773T
p.A147V
p.A147V
p.A258V
22.1-Krumm2015 E
POC1B     14444.p1chr12:
89918931-89918931
GAexonicDe novononsynonymous SNVNM_001199782c.C326Tp.P109L16.54-Krumm2015 E
CYB561D1     14252.p1chr1:
110038457-110038457
GTexonicDe novostopgainNM_001134403c.G370Tp.G124X20.38.237E-6Krumm2015 E
DHCR24     12198.p1chr1:
55337173-55337173
GCexonicDe novononsynonymous SNVNM_014762c.C726Gp.F242L12.88-Krumm2015 E
PAN2     12772.p1chr12:
56720411-56720411
GAexonicDe novononsynonymous SNVNM_001127460
NM_001166279
NM_014871
c.C1252T
c.C1252T
c.C1252T
p.P418S
p.P418S
p.P418S
16.389.506E-6Krumm2015 E
WSCD2     13864.p1chr12:
108618620-108618620
GTexonicDe novononsynonymous SNVNM_014653
NM_001304447
c.G787T
c.G787T
p.D263Y
p.D263Y
24.1-Krumm2015 E
GPATCH8     11161.p1chr17:
42476555-42476555
TCexonicDe novononsynonymous SNVNM_001304943
NM_001304939
NM_001304942
NM_001002909
NM_001304941
NM_001304940
c.A2656G
c.A2815G
c.A2656G
c.A2890G
c.A2656G
c.A2656G
p.S886G
p.S939G
p.S886G
p.S964G
p.S886G
p.S886G
13.11-Krumm2015 E
GALNTL5     13556.p1chr7:
151684364-151684364
CTexonicDe novononsynonymous SNVNM_145292c.C656Tp.S219L17.61-Krumm2015 E
RNF128     12597.p1chrX:
106031215-106031215
GAexonicDe novononsynonymous SNVNM_024539
NM_194463
c.G794A
c.G872A
p.R265H
p.R291H
23.4-Krumm2015 E
GALNTL6     12641.p1chr4:
173873251-173873251
CGexonicDe novononsynonymous SNVNM_001034845c.C1213Gp.P405A25.14.969E-5Krumm2015 E
AMIGO2     14017.p1chr12:
47472267-47472267
ACexonicDe novononsynonymous SNVNM_181847
NM_001143668
c.T519G
c.T519G
p.S173R
p.S173R
16.82-Krumm2015 E
CIT     12087.p1chr12:
120156179-120156179
AGexonicDe novononsynonymous SNVNM_007174
NM_001206999
c.T3913C
c.T4039C
p.S1305P
p.S1347P
16.628.291E-6Krumm2015 E
OCIAD1     13829.p1chr4:
48852062-48852062
TGexonicDe novononsynonymous SNVNM_001079839
NM_001079840
NM_001079841
NM_001079842
NM_001168254
NM_017830
c.T340G
c.T340G
c.T340G
c.T340G
c.T355G
c.T340G
p.L114V
p.L114V
p.L114V
p.L114V
p.L119V
p.L114V
17.65-Krumm2015 E
MPEG1     13617.p1chr11:
58979891-58979891
CGexonicDe novononsynonymous SNVNM_001039396c.G448Cp.V150L18.07-Krumm2015 E
WWOX     12228.p1chr16:
79245677-79245677
GCexonicDe novononsynonymous SNVNM_001291997
NM_016373
c.G890C
c.G1229C
p.G297A
p.G410A
16.092.0E-4Krumm2015 E
KNG1     13829.p1chr3:
186460067-186460067
AGexonicDe novononsynonymous SNVNM_001102416c.A1882Gp.T628A11.34-Krumm2015 E
THEMIS     12153.p1chr6:
128151058-128151058
TCexonicDe novononsynonymous SNVNM_001010923
NM_001164685
NM_001164687
c.A272G
c.A272G
c.A167G
p.D91G
p.D91G
p.D56G
19.61-Krumm2015 E
WWP2     12785.p1chr16:
69922119-69922119
CTexonicDe novononsynonymous SNVNM_001270453
NM_001270454
NM_001270455
NM_007014
c.C533T
c.C881T
c.C881T
c.C881T
p.A178V
p.A294V
p.A294V
p.A294V
14.088.296E-6Krumm2015 E
HCAR1     12483.p1chr12:
123214180-123214180
CTexonicDe novononsynonymous SNVNM_032554c.G707Ap.S236N19.74-Krumm2015 E
BRD4     13256.p1chr19:
15375549-15375549
TCexonicDe novononsynonymous SNVNM_014299
NM_058243
c.A878G
c.A878G
p.D293G
p.D293G
27.1-Krumm2015 E
SCAND1     11740.p1chr20:
34542214-34542214
GCexonicDe novononsynonymous SNVNM_033630c.C182Gp.A61G--Krumm2015 E
CYLC1     12522.p1chrX:
83128308-83128308
ATexonicDe novostopgainNM_021118c.A592Tp.K198X17.51-Krumm2015 E
NCKAP5L     13290.p1chr12:
50188719-50188719
GAexonicDe novononsynonymous SNVNM_001037806c.C2924Tp.A975V21.4-Krumm2015 E
PTGER4     14180.p1chr5:
40692019-40692019
GTexonicDe novononsynonymous SNVNM_000958c.G1006Tp.V336L18.21-Krumm2015 E
LIMD1     12779.p1chr3:
45636589-45636589
GAexonicDe novononsynonymous SNVNM_014240c.G218Ap.G73E10.578.604E-6Krumm2015 E
OFD1     13134.p1chrX:
13774696-13774696
GTsplicingDe novosplicing16.35-Krumm2015 E
ZNF462     13842.p1chr9:
109691619-109691619
CTexonicDe novononsynonymous SNVNM_021224c.C5426Tp.A1809V13.271.657E-5Krumm2015 E
IPO4     12198.p1chr14:
24650802-24650802
CGexonicDe novononsynonymous SNVNM_024658c.G2962Cp.A988P16.522.0E-4Krumm2015 E
UBR5     11102.p1chr8:
103307441-103307441
TGexonicDe novononsynonymous SNVNM_001282873
NM_015902
c.A4049C
c.A4049C
p.N1350T
p.N1350T
18.08-Krumm2015 E
XIRP1     12379.p1chr3:
39230164-39230164
CTexonicDe novononsynonymous SNVNM_001198621
NM_194293
c.G773A
c.G773A
p.R258Q
p.R258Q
29.22.0E-4Krumm2015 E
ZNF486     13769.p1chr19:
20296810-20296813
AAGCTexonicDe novononframeshift substitutionNM_052852c.172_175TN/A--Krumm2015 E
PEG10     13604.p1chr7:
94293229-94293229
GAexonicDe novononsynonymous SNVNM_001040152
NM_001172438
NM_001184962
c.G361A
c.G589A
c.G463A
p.V121M
p.V197M
p.V155M
15.64-Krumm2015 E
NCR1     14300.p1chr19:
55418040-55418040
GAexonicDe novononsynonymous SNVNM_001145457
NM_001145458
NM_004829
c.G230A
c.G230A
c.G230A
p.R77Q
p.R77Q
p.R77Q
10.541.651E-5Krumm2015 E
CYP26A1     14519.p1chr10:
94836446-94836446
AGexonicDe novononsynonymous SNVNM_000783
NM_057157
c.A1145G
c.A938G
p.E382G
p.E313G
17.14-Krumm2015 E
BRSK1     11944.p1chr19:
55805700-55805701
GAGexonicDe novoframeshift deletionNM_032430c.614delAp.E205fs--Krumm2015 E
NDC80     12842.p1chr18:
2595619-2595619
CTexonicDe novononsynonymous SNVNM_006101c.C1220Tp.A407V14.918.376E-6Krumm2015 E
SH3BP5L     14420.p1chr1:
249106247-249106247
AGexonicDe novononsynonymous SNVNM_030645c.T1034Cp.L345P16.7-Krumm2015 E
MEF2B     13102.p1chr19:
19257456-19257456
CTexonicDe novononsynonymous SNVNM_001145785
NM_005919
c.G677A
c.G677A
p.R226K
p.R226K
10.92-Krumm2015 E
HSPG2     11442.p1chr1:
22199230-22199230
GTexonicDe novostopgainNM_001291860
NM_005529
c.C3915A
c.C3912A
p.C1305X
p.C1304X
42.0-Krumm2015 E
IQCB1     13621.p1chr3:
121507230-121507230
ACexonicDe novononsynonymous SNVNM_001023571
NM_001023570
c.T780G
c.T1179G
p.I260M
p.I393M
17.68-Krumm2015 E
RNF213     13319.p1chr17:
78263533-78263533
GAexonicDe novononsynonymous SNVNM_001256071
NM_020954
c.G1009A
c.G1009A
p.E337K
p.E337K
10.39-Krumm2015 E
SH3PXD2A     12228.p1chr10:
105495554-105495554
AGexonicDe novononsynonymous SNVNM_014631c.T242Cp.F81S17.81-Krumm2015 E
LYSMD4     12820.p1chr15:
100272044-100272044
TCexonicDe novononsynonymous SNVNM_001284417
NM_001284418
NM_001284419
NM_152449
c.A161G
c.A161G
c.A73G
c.A73G
p.E54G
p.E54G
p.S25G
p.S25G
17.83-Krumm2015 E
XPO4     13017.p1chr13:
21370323-21370323
GAexonicDe novostopgainNM_022459c.C2689Tp.Q897X39.0-Krumm2015 E
IQGAP1     13762.p1chr15:
91010810-91010810
CTexonicDe novononsynonymous SNVNM_003870c.C2164Tp.R722W15.0-Krumm2015 E
ZNF536     11588.p1chr19:
31039705-31039706
ACAexonicDe novoframeshift deletionNM_014717c.3180delCp.N1060fs--Krumm2015 E
SH3TC1     12828.p1chr4:
8230140-8230140
GAexonicDe novononsynonymous SNVNM_018986c.G2719Ap.A907T18.03-Krumm2015 E
ASH1L     11282.p1chr1:
155317482-155317482
CCCTTGexonicDe novoframeshift insertionNM_018489c.7767_7768insCAAGp.D2590fs--Krumm2015 E
OPN1MW     12228.p1chrX:
153496186-153496186
CGexonicDe novononsynonymous SNVNM_000513
NM_001048181
c.C914G
c.C914G
p.A305G
p.A305G
19.121.0E-4Krumm2015 E
CD109     11336.p1chr6:
74440138-74440147
CTCTAATAGTCexonicDe novononframeshift deletionNM_001159587
NM_133493
c.349_357del
c.349_357del
p.117_119del
p.117_119del
--Krumm2015 E
FLRT1     12494.p1chr11:
63884337-63884337
CGexonicDe novononsynonymous SNVNM_013280c.C598Gp.L200V15.04-Krumm2015 E
NPDC1     11161.p1chr9:
139934810-139934810
GAexonicDe novononsynonymous SNVNM_015392c.C787Tp.R263W14.7-Krumm2015 E
SCN4A     13646.p1chr17:
62049125-62049125
GAexonicDe novononsynonymous SNVNM_000334c.C568Tp.R190W19.761.273E-5Krumm2015 E
ATR     12611.p1chr3:
142185303-142185303
TCexonicDe novononsynonymous SNVNM_001184c.A6760Gp.T2254A14.61-Krumm2015 E
PEX11B     13336.p1chr1:
145517271-145517271
AGsplicingDe novosplicing19.0-Krumm2015 E
HEATR5B     13963.p1chr2:
37234420-37234420
AGexonicDe novononsynonymous SNVNM_019024c.T4550Cp.I1517T14.126.604E-5Krumm2015 E
TRUB1     14675.p1chr10:
116730168-116730168
TCexonicDe novononsynonymous SNVNM_139169c.T565Cp.F189L28.8-Krumm2015 E
CELF4     14214.p1chr18:
34855162-34855162
CAexonicDe novostopgainNM_001025087
NM_001025088
NM_001025089
NM_020180
c.G493T
c.G490T
c.G463T
c.G493T
p.E165X
p.E164X
p.E155X
p.E165X
40.0-Krumm2015 E
GALNT18     13548.p1chr11:
11314679-11314690
TCATCCACGGTGTGTexonicDe novononframeshift substitutionNM_198516c.1563_1573ACN/A--Krumm2015 E
AMZ1     13322.p1chr7:
2748240-2748243
TGAATexonicDe novononframeshift deletionNM_001284355
NM_133463
c.492_494del
c.492_494del
p.164_165del
p.164_165del
-5.0E-4Krumm2015 E
CA9     11085.p1chr9:
35676349-35676349
GAexonicDe novononsynonymous SNVNM_001216c.G803Ap.R268H12.238.328E-6Krumm2015 E
ANKDD1A     11124.p1chr15:
65239714-65239714
CGexonicDe novononsynonymous SNVNM_182703c.C1252Gp.L418V16.23-Krumm2015 E
ABCE1     13548.p1chr4:
146044179-146044179
GAexonicDe novononsynonymous SNVNM_001040876
NM_002940
c.G1270A
c.G1270A
p.V424I
p.V424I
34.0-Krumm2015 E
ERLEC1     14427.p1chr2:
54040122-54040122
AGexonicDe novononsynonymous SNVNM_001127398
NM_001127397
NM_015701
c.A976G
c.A1138G
c.A1138G
p.T326A
p.T380A
p.T380A
18.95-Krumm2015 E
TNFSF10     14695.p1chr3:
172224677-172224677
TCexonicDe novononsynonymous SNVNM_003810c.A451Gp.I151V15.3-Krumm2015 E
SHF     12123.p1chr15:
45465888-45465888
GAexonicDe novononsynonymous SNVNM_138356c.C679Tp.P227S27.9-Krumm2015 E
IRF8     12429.p1chr16:
85952187-85952187
GAexonicDe novononsynonymous SNVNM_002163c.G766Ap.D256N19.538.864E-6Krumm2015 E
ROBO3     12821.p1chr11:
124747997-124747997
GAexonicDe novononsynonymous SNVNM_022370c.G3151Ap.A1051T17.619.839E-6Krumm2015 E
BZW2     14327.p1chr7:
16737680-16737680
CTexonicDe novononsynonymous SNVNM_001159767
NM_014038
c.C977T
c.C977T
p.A326V
p.A326V
22.8-Krumm2015 E
FAM92B     13796.p1chr16:
85143894-85143894
GAexonicDe novononsynonymous SNVNM_198491c.C193Tp.R65W15.68-Krumm2015 E
RBFOX2     12354.p1chr22:
36140283-36140283
CTexonicDe novononsynonymous SNVNM_001082577
NM_014309
NM_001031695
NM_001082576
NM_001082578
NM_001082579
c.G1072A
c.G1063A
c.G1112A
c.G1100A
c.G1325A
c.G1322A
p.E358K
p.E355K
p.R371Q
p.R367Q
p.R442Q
p.R441Q
24.8-Krumm2015 E
CCDC184     14348.p1chr12:
48578060-48578060
AGexonicDe novononsynonymous SNVNM_001013635c.A155Gp.Q52R13.19-Krumm2015 E
PTPN9     14284.p1chr15:
75815580-75815580
GAexonicDe novononsynonymous SNVNM_002833c.C304Tp.R102W21.5-Krumm2015 E
METTL11B     13312.p1chr1:
170136849-170136849
AGexonicDe novononsynonymous SNVNM_001136107c.A803Gp.Q268R13.11-Krumm2015 E
C10orf53     11108.p1chr10:
50887799-50887799
TCexonicDe novononsynonymous SNVNM_001042427
NM_182554
c.T56C
c.T56C
p.L19P
p.L19P
18.23-Krumm2015 E
HECTD4     12540.p1chr12:
112638596-112638596
CAexonicDe novostopgainNM_001109662c.G8011Tp.E2671X54.0-Krumm2015 E
CELSR3     12924.p1chr3:
48682259-48682259
GAexonicDe novononsynonymous SNVNM_001407c.C7975Tp.L2659F23.4-Krumm2015 E
GCGR     13309.p1chr17:
79768754-79768754
GAexonicDe novononsynonymous SNVNM_000160c.G217Ap.A73T11.16-Krumm2015 E
TBC1D1     14315.p1chr4:
38051327-38051327
CTexonicDe novononsynonymous SNVNM_001253912
NM_015173
c.C1718T
c.C1718T
p.S573L
p.S573L
10.921.649E-5Krumm2015 E
ATP12A     13578.p1chr13:
25280524-25280534
GCCAACTACCACCCCGexonicDe novononframeshift substitutionNM_001185085
NM_001676
c.2110_2120CCCCG
c.2092_2102CCCCG
N/A
N/A
--Krumm2015 E
C10orf71     11167.p1chr10:
50534797-50534797
GAexonicDe novononsynonymous SNVNM_001135196c.G4207Ap.G1403S12.55-Krumm2015 E
ADGRG1     13188.p1chr16:
57697480-57697480
TCexonicDe novononsynonymous SNVNM_001145773
NM_001290142
NM_001290143
NM_001290144
NM_201525
NM_001145770
NM_001145771
NM_001145772
NM_001145774
NM_005682
NM_201524
c.T2065C
c.T1558C
c.T1543C
c.T1525C
c.T2050C
c.T2050C
c.T2068C
c.T2050C
c.T2050C
c.T2068C
c.T2050C
p.S689P
p.S520P
p.S515P
p.S509P
p.S684P
p.S684P
p.S690P
p.S684P
p.S684P
p.S690P
p.S684P
14.511.678E-5Krumm2015 E
EFNB3     11579.p1chr17:
7611349-7611349
CTexonicDe novononsynonymous SNVNM_001406c.C196Tp.R66W18.652.505E-5Krumm2015 E
FMO5     12565.p1chr1:
146672986-146672986
CGexonicDe novononsynonymous SNVNM_001144829
NM_001461
c.G931C
c.G931C
p.A311P
p.A311P
22.64.0E-4Krumm2015 E
ADRM1     11215.p1chr20:
60883783-60883783
ACexonicDe novononsynonymous SNVNM_001281437
NM_001281438
NM_007002
NM_175573
c.A1073C
c.A1073C
c.A1190C
c.A1190C
p.K358T
p.K358T
p.K397T
p.K397T
20.7-Krumm2015 E
TBC1D24     12638.p1chr16:
2546400-2546400
ACexonicDe novononsynonymous SNVNM_001199107
NM_020705
c.A251C
c.A251C
p.K84T
p.K84T
16.07-Krumm2015 E
PLEC     13759.p1chr8:
144996005-144996005
CTexonicDe novononsynonymous SNVNM_201378
NM_201379
NM_201380
NM_201381
NM_201382
NM_201383
NM_201384
NM_000445
c.G7942A
c.G7918A
c.G8395A
c.G7888A
c.G7984A
c.G7996A
c.G7984A
c.G8065A
p.G2648S
p.G2640S
p.G2799S
p.G2630S
p.G2662S
p.G2666S
p.G2662S
p.G2689S
13.12-Krumm2015 E
PPP1R35     14043.p1chr7:
100033271-100033271
GCexonicDe novononsynonymous SNVNM_145030c.C571Gp.R191G16.22-Krumm2015 E
RBM27       12497.p1chr5:
145603023-145603023
CTexonicDe novononsynonymous SNVNM_018989c.C236Tp.P79L19.02-Krumm2015 E
MRPL38     13894.p1chr17:
73894951-73894951
GTexonicDe novononsynonymous SNVNM_032478c.C1123Ap.P375T19.72-Krumm2015 E
KRT76     12093.p1chr12:
53167397-53167397
GTexonicDe novononsynonymous SNVNM_015848c.C845Ap.A282D10.89-Krumm2015 E
FN1     13573.p1chr2:
216251636-216251636
TGexonicDe novononsynonymous SNVNM_001306131
NM_001306132
NM_002026
NM_212474
NM_212476
NM_212478
NM_001306129
NM_001306130
NM_212482
c.A4115C
c.A4115C
c.A4115C
c.A4115C
c.A4115C
c.A4115C
c.A4388C
c.A4388C
c.A4388C
p.N1372T
p.N1372T
p.N1372T
p.N1372T
p.N1372T
p.N1372T
p.N1463T
p.N1463T
p.N1463T
12.02-Krumm2015 E
HECW2     14606.p1chr2:
197084846-197084846
TCexonicDe novononsynonymous SNVNM_001304840
NM_020760
c.A3257G
c.A4325G
p.D1086G
p.D1442G
26.1-Krumm2015 E
DLAT     14011.p1chr11:
111933213-111933213
CTexonicDe novononsynonymous SNVNM_001931c.C1898Tp.A633V18.71-Krumm2015 E
CPSF3     13311.p1chr2:
9588447-9588447
ACexonicDe novononsynonymous SNVNM_016207c.A1363Cp.T455P16.67-Krumm2015 E
ARID5B     13166.p1chr10:
63851326-63851326
GCexonicDe novononsynonymous SNVNM_001244638
NM_032199
c.G1375C
c.G2104C
p.A459P
p.A702P
14.668.42E-5Krumm2015 E
ZNF678     13104.p1chr1:
227843134-227843134
CAexonicDe novononsynonymous SNVNM_178549c.C1348Ap.H450N12.44-Krumm2015 E
TLE2     11420.p1chr19:
3005882-3005882
TCexonicDe novononsynonymous SNVNM_001144762
NM_001300846
NM_003260
NM_001144761
c.A1219G
c.A1588G
c.A1585G
c.A1627G
p.I407V
p.I530V
p.I529V
p.I543V
14.92-Krumm2015 E
PLEKHA6     14292.p1chr1:
204218371-204218371
CTexonicDe novononsynonymous SNVNM_014935c.G1615Ap.E539K33.0-Krumm2015 E
UNC13B     13645.p1chr9:
35381599-35381599
GCexonicDe novononsynonymous SNVNM_006377c.G2291Cp.R764P17.45-Krumm2015 E
TBC1D31     13581.p1chr8:
124113166-124113166
TAexonicDe novononsynonymous SNVNM_001145088
NM_145647
c.T951A
c.T951A
p.H317Q
p.H317Q
14.69-Krumm2015 E
AFAP1L1     13187.p1chr5:
148699277-148699277
CTexonicDe novononsynonymous SNVNM_001146337
NM_152406
c.C1612T
c.C1612T
p.R538C
p.R538C
21.61.739E-5Krumm2015 E
DAG1     12418.p1chr3:
49569736-49569736
CTexonicDe novononsynonymous SNVNM_001177639
NM_001177643
NM_001177644
NM_004393
NM_001177635
NM_001177637
NM_001177638
NM_001177640
NM_001177641
NM_001177642
NM_001177636
NM_001165928
NM_001177634
c.C1792T
c.C1792T
c.C1792T
c.C1792T
c.C1792T
c.C1792T
c.C1792T
c.C1792T
c.C1792T
c.C1792T
c.C1792T
c.C1792T
c.C1792T
p.R598C
p.R598C
p.R598C
p.R598C
p.R598C
p.R598C
p.R598C
p.R598C
p.R598C
p.R598C
p.R598C
p.R598C
p.R598C
14.268.289E-6Krumm2015 E
SIGLEC5       13019.p1chr19:
52133140-52133140
CGexonicDe novononsynonymous SNVNM_003830c.G367Cp.G123R14.95-Krumm2015 E
MRPS30     11793.p1chr5:
44809375-44809375
GTexonicDe novononsynonymous SNVNM_016640c.G311Tp.R104L25.1-Krumm2015 E
PTPRS     12603.p1chr19:
5225807-5225807
CAexonicDe novononsynonymous SNVNM_130854
NM_002850
c.G2359T
c.G2425T
p.V787L
p.V809L
18.56-Krumm2015 E
GPRIN2     13775.p1chr10:
46998925-46998925
CGexonicDe novononsynonymous SNVNM_014696c.C45Gp.S15R14.226.528E-5Krumm2015 E
TKFC     14142.p1chr11:
61106538-61106538
GAexonicDe novononsynonymous SNVNM_015533c.G194Ap.G65D26.4-Krumm2015 E
LOXL1     14240.p1chr15:
74238793-74238793
TAexonicDe novononsynonymous SNVNM_005576c.T1247Ap.V416E13.92-Krumm2015 E
ITGB1     11568.p1chr10:
33200439-33200439
GAexonicDe novononsynonymous SNVNM_033668
NM_002211
NM_133376
c.C1868T
c.C1868T
c.C1868T
p.P623L
p.P623L
p.P623L
19.013.295E-5Krumm2015 E
PTPRT     12198.p1chr20:
41419995-41419995
AGexonicDe novononsynonymous SNVNM_007050
NM_133170
c.T326C
c.T326C
p.F109S
p.F109S
18.378.29E-6Krumm2015 E
ZNF76     13195.p1chr6:
35259344-35259344
CTexonicDe novononsynonymous SNVNM_001292032
NM_003427
c.C761T
c.C761T
p.P254L
p.P254L
27.08.255E-6Krumm2015 E
STOX2     13540.p1chr4:
184931420-184931420
CTexonicDe novononsynonymous SNVNM_020225c.C1429Tp.R477W15.413.141E-5Krumm2015 E
RPL19     12772.p1chr17:
37360818-37360818
CGexonicDe novononsynonymous SNVNM_000981c.C508Gp.R170G16.59-Krumm2015 E
TBCEL     12274.p1chr11:
120926018-120926018
GTsplicingDe novosplicing23.6-Krumm2015 E
ANKRD66     11403.p1chr6:
46719684-46719684
CTexonicDe novononsynonymous SNVNM_001162435c.C164Tp.A55V--Krumm2015 E
CHD8     13900.p1chr14:
21896036-21896036
GAexonicDe novosynonymous SNVNM_001170629
NM_020920
c.C1593T
c.C756T
p.S531S
p.S252S
--Krumm2015 E
ZBTB45     14231.p1chr19:
59028431-59028433
CAGCexonicDe novoframeshift deletionNM_001316978
NM_001316979
NM_001316980
NM_001316981
NM_001316982
NM_032792
c.608_609del
c.608_609del
c.608_609del
c.608_609del
c.608_609del
c.608_609del
p.P203fs
p.P203fs
p.P203fs
p.P203fs
p.P203fs
p.P203fs
--Krumm2015 E
MSANTD2     12019.p1chr11:
124637785-124637785
GAexonicDe novononsynonymous SNVNM_001312920
NM_001308027
NM_001312921
NM_024631
c.C277T
c.C967T
c.C277T
c.C811T
p.R93C
p.R323C
p.R93C
p.R271C
18.268.247E-6Krumm2015 E
FOXI3     12077.p1chr2:
88751635-88751635
CGexonicDe novounknown--Krumm2015 E
MSANTD3     13139.p1chr9:
103213241-103213241
CTexonicDe novononsynonymous SNVNM_001198805
NM_001198806
NM_080655
c.C821T
c.C821T
c.C821T
p.S274L
p.S274L
p.S274L
23.92.74E-5Krumm2015 E
UNC5C     11117.p1chr4:
96469999-96470002
CTTTAexonicDe novononframeshift substitutionNM_003728c.7_10TN/A--Krumm2015 E
HEXDC     13639.p1chr17:
80400334-80400334
CTexonicDe novononsynonymous SNVNM_173620c.C1624Tp.R542W15.074.279E-5Krumm2015 E
SPATA31A6     13552.p1chr9:
43627396-43627396
CTexonicDe novononsynonymous SNVNM_001145196c.G1291Ap.A431T15.034.0E-4Krumm2015 E
GRB10     12676.p1chr7:
50737559-50737559
GAexonicDe novononsynonymous SNVNM_001001549
NM_001001550
NM_005311
NM_001001555
c.C364T
c.C190T
c.C364T
c.C190T
p.R122C
p.R64C
p.R122C
p.R64C
15.06-Krumm2015 E
NRROS     12588.p1chr3:
196387092-196387092
TCexonicDe novononsynonymous SNVNM_198565c.T578Cp.I193T21.9-Krumm2015 E
SIRT1     13932.p1chr10:
69672259-69672259
AGexonicDe novononsynonymous SNVNM_001314049
NM_001142498
NM_012238
c.A477G
c.A501G
c.A1386G
p.I159M
p.I167M
p.I462M
17.33-Krumm2015 E
IFRD2     12591.p1chr3:
50326069-50326069
CTexonicDe novononsynonymous SNVNM_006764c.G1289Ap.R430Q24.56.699E-5Krumm2015 E
MGAT5B     14048.p1chr17:
74944056-74944056
CTexonicDe novononsynonymous SNVNM_198955
NM_001199172
NM_144677
c.C2095T
c.C2068T
c.C2062T
p.R699W
p.R690W
p.R688W
21.48.953E-6Krumm2015 E
PHGDH     14330.p1chr1:
120283134-120283134
AGexonicDe novononsynonymous SNVNM_006623c.A1071Gp.I357M12.11-Krumm2015 E
MGEA5     11366.p1chr10:
103557857-103557857
TAexonicDe novononsynonymous SNVNM_001142434
NM_012215
c.A1705T
c.A1864T
p.M569L
p.M622L
11.43-Krumm2015 E
ZC3H18     14039.p1chr16:
88691091-88691091
CCAAGCCAGGAGACCCTCGGGexonicDe novoframeshift insertionNM_144604
NM_001294340
c.1980_1981insAAGCCAGGAGACCCTCGGG
c.2052_2053insAAGCCAGGAGACCCTCGGG
p.T660fs
p.T684fs
--Krumm2015 E
EIF5     12224.p1chr14:
103806868-103806871
CGAACexonicDe novononframeshift deletionNM_183004
NM_001969
c.1177_1179del
c.1177_1179del
p.393_393del
p.393_393del
-2.475E-5Krumm2015 E
CMYA5     11436.p1chr5:
79095431-79095431
CGexonicDe novononsynonymous SNVNM_153610c.C12202Gp.H4068D19.36-Krumm2015 E
RPS15     14588.p1chr19:
1438831-1438831
GTexonicDe novononsynonymous SNVNM_001018
NM_001308226
c.G29T
c.G50T
p.R10L
p.R17L
25.1-Krumm2015 E
IFT122     13266.p1chr3:
129239066-129239066
CGexonicDe novononsynonymous SNVNM_052990
NM_001280546
NM_018262
NM_001280541
NM_052989
NM_001280545
NM_052985
c.C3354G
c.C3057G
c.C3507G
c.C3663G
c.C3684G
c.C3234G
c.C3837G
p.C1118W
p.C1019W
p.C1169W
p.C1221W
p.C1228W
p.C1078W
p.C1279W
13.591.839E-5Krumm2015 E
EXOC1     11246.p1chr4:
56756552-56756552
GTexonicDe novononsynonymous SNVNM_178237
NM_001024924
NM_018261
c.G1494T
c.G1539T
c.G1539T
p.K498N
p.K513N
p.K513N
26.5-Krumm2015 E
NEMF     11676.p1chr14:
50307512-50307512
CAexonicDe novononsynonymous SNVNM_001301732
NM_004713
c.G430T
c.G430T
p.D144Y
p.D144Y
27.4-Krumm2015 E
C16orf62     13324.p1chr16:
19567064-19567064
CTexonicDe novononsynonymous SNVNM_001300743
NM_020314
c.C280T
c.C280T
p.P94S
p.P94S
15.98-Krumm2015 E
DMXL2     14077.p1chr15:
51766611-51766611
CTexonicDe novononsynonymous SNVNM_001174117
NM_001174116
NM_015263
c.G5232A
c.G7143A
c.G7140A
p.M1744I
p.M2381I
p.M2380I
28.1-Krumm2015 E
GIGYF1     11860.p1chr7:
100279943-100279943
AGsplicingDe novosplicing10.85-Krumm2015 E
ZNF90     11470.p1chr19:
20229093-20229093
CTexonicDe novononsynonymous SNVNM_007138c.C730Tp.L244F10.29-Krumm2015 E
REPIN1     11003.p1chr7:
150068814-150068814
GAexonicDe novononsynonymous SNVNM_014374
NM_001099696
NM_001099695
NM_013400
c.G484A
c.G484A
c.G655A
c.G484A
p.A162T
p.A162T
p.A219T
p.A162T
15.53-Krumm2015 E
RERE     11654.p1chr1:
8421289-8421289
GAexonicDe novostopgainNM_001042682
NM_001042681
NM_012102
c.C616T
c.C2278T
c.C2278T
p.Q206X
p.Q760X
p.Q760X
39.0-Krumm2015 E
GIGYF2     13611.p1chr2:
233712061-233712061
CGexonicDe novononsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.C3446G
c.C3464G
c.C3527G
c.C3464G
p.P1149R
p.P1155R
p.P1176R
p.P1155R
23.4-Krumm2015 E
ANP32A     13987.p1chr15:
69080207-69080223
CTTCGAGTTTGCCTTCACexonicDe novoframeshift deletionNM_006305c.90_105delp.N30fs--Krumm2015 E
SPEN     12120.p1chr1:
16257386-16257386
GAexonicDe novononsynonymous SNVNM_015001c.G4651Ap.E1551K19.83-Krumm2015 E
VWF     11641.p1chr12:
6094774-6094774
CTexonicDe novononsynonymous SNVNM_000552c.G6856Ap.G2286R14.468.348E-6Krumm2015 E
PHRF1     12341.p1chr11:
610966-610966
CGexonicDe novononsynonymous SNVNM_001286581
NM_001286582
NM_001286583
NM_020901
c.C4690G
c.C4684G
c.C4678G
c.C4687G
p.L1564V
p.L1562V
p.L1560V
p.L1563V
16.18-Krumm2015 E
IFT81     12380.p1chr12:
110565272-110565272
GCexonicDe novononsynonymous SNVNM_001143779
NM_014055
NM_031473
c.G87C
c.G87C
c.G87C
p.L29F
p.L29F
p.L29F
17.75.322E-5Krumm2015 E
NFAM1     14354.p1chr22:
42805532-42805532
GAexonicDe novononsynonymous SNVNM_145912c.C473Tp.P158L15.821.756E-5Krumm2015 E
GRIK5     13628.p1chr19:
42546852-42546852
CTexonicDe novononsynonymous SNVNM_001301030
NM_002088
c.G1325A
c.G1325A
p.R442H
p.R442H
26.28.51E-6Krumm2015 E
NFATC1     12961.p1chr18:
77160481-77160481
TGsplicingDe novosplicing12.47-Krumm2015 E
GIT1     13911.p1chr17:
27903116-27903116
CGexonicDe novononsynonymous SNVNM_014030
NM_001085454
c.G1645C
c.G1672C
p.V549L
p.V558L
10.81-Krumm2015 E
CFAP46     11482.p1chr10:
134752145-134752145
CTexonicDe novononsynonymous SNVNM_001200049c.G484Ap.V162M12.592.484E-5Krumm2015 E
NFATC4     13760.p1chr14:
24843068-24843068
ACexonicDe novononsynonymous SNVNM_001198965
NM_001198966
NM_001288802
NM_004554
NM_001136022
NM_001198967
c.A1727C
c.A1517C
c.A1691C
c.A1727C
c.A1916C
c.A1916C
p.E576A
p.E506A
p.E564A
p.E576A
p.E639A
p.E639A
21.5-Krumm2015 E
KIF14     14357.p1chr1:
200584483-200584483
GAexonicDe novononsynonymous SNVNM_014875c.C1367Tp.T456M31.0-Krumm2015 E
PI16     13454.p1chr6:
36931014-36931014
CTexonicDe novononsynonymous SNVNM_153370
NM_001199159
c.C896T
c.C896T
p.S299F
p.S299F
11.76-Krumm2015 E
NFIA     14127.p1chr1:
61818236-61818236
CTexonicDe novononsynonymous SNVNM_001134673
NM_001145511
NM_005595
NM_001145512
c.C815T
c.C791T
c.C815T
c.C950T
p.T272M
p.T264M
p.T272M
p.T317M
21.18.249E-6Krumm2015 E
MIDN     12103.p1chr19:
1257077-1257077
CGexonicDe novononsynonymous SNVNM_177401c.C1213Gp.R405G23.5-Krumm2015 E
PYHIN1     14300.p1chr1:
158906752-158906752
AGexonicDe novononsynonymous SNVNM_152501
NM_198928
NM_198929
NM_198930
c.A52G
c.A52G
c.A52G
c.A52G
p.N18D
p.N18D
p.N18D
p.N18D
12.15-Krumm2015 E
PLXNA3     13250.p1chrX:
153692845-153692845
GAsplicingDe novosplicing15.65-Krumm2015 E
DCTN1     11986.p1chr2:
74597859-74597859
TCexonicDe novononsynonymous SNVNM_001135041
NM_023019
NM_001135040
NM_001190836
NM_001190837
NM_004082
c.A535G
c.A535G
c.A877G
c.A826G
c.A916G
c.A937G
p.M179V
p.M179V
p.M293V
p.M276V
p.M306V
p.M313V
23.0-Krumm2015 E
DNAH10     14248.p1chr12:
124303750-124303750
GAexonicDe novononsynonymous SNVNM_207437c.G3599Ap.R1200H18.069.211E-6Krumm2015 E
TPT1     11703.p1chr13:
45911523-45911523
AAACATTTTTCCATTTCTAAACCATexonicDe novoframeshift insertionNM_001286273
NM_003295
c.414_415insATGGTTTAGAAATGGAAAAATGT
c.516_517insATGGTTTAGAAATGGAAAAATGT
p.X139delinsMVX
p.X173delinsMVX
--Krumm2015 E
JAKMIP1     12607.p1chr4:
6064121-6064121
CTexonicDe novononsynonymous SNVNM_001306134
NM_001099433
NM_001306133
NM_144720
c.G983A
c.G1478A
c.G1478A
c.G1478A
p.R328Q
p.R493Q
p.R493Q
p.R493Q
16.241.674E-5Krumm2015 E
GJB7     13719.p1chr6:
87994110-87994110
GTexonicDe novononsynonymous SNVNM_198568c.C521Ap.T174N16.23-Krumm2015 E
BCAM     11928.p1chr19:
45315607-45315607
CTexonicDe novononsynonymous SNVNM_001013257
NM_005581
c.C392T
c.C392T
p.A131V
p.A131V
17.59-Krumm2015 E
DDA1     13329.p1chr19:
17430449-17430449
TCexonicDe novononsynonymous SNVNM_024050c.T293Cp.M98T13.253.736E-5Krumm2015 E
SPNS3     12355.p1chr17:
4389753-4389753
GAexonicDe novononsynonymous SNVNM_182538c.G1325Ap.R442H10.241.678E-5Krumm2015 E
HIVEP1     14176.p1chr6:
12121059-12121059
ACexonicDe novononsynonymous SNVNM_002114c.A1031Cp.Q344P16.65-Krumm2015 E
TRAF4     12728.p1chr17:
27076365-27076365
GCexonicDe novononsynonymous SNVNM_004295c.G1183Cp.D395H21.5-Krumm2015 E
FRMPD4     12296.p1chrX:
12627964-12627964
AGexonicDe novononsynonymous SNVNM_014728c.A283Gp.S95G18.84-Krumm2015 E
ZFPM2     11442.p1chr8:
106814868-106814868
AGexonicDe novononsynonymous SNVNM_012082c.A2558Gp.Y853C15.81-Krumm2015 E
TRAF7     13983.p1chr16:
2226351-2226351
GAexonicDe novononsynonymous SNVNM_032271c.G1964Ap.R655Q18.65-Krumm2015 E
MTMR3     14011.p1chr22:
30409469-30409469
ATexonicDe novononsynonymous SNVNM_021090
NM_153050
NM_153051
c.A1442T
c.A1442T
c.A1442T
p.D481V
p.D481V
p.D481V
27.89.886E-5Krumm2015 E
ASPHD2     13499.p1chr22:
26830090-26830090
TCexonicDe novononsynonymous SNVNM_020437c.T509Cp.L170P19.39-Krumm2015 E
CGNL1     13494.p1chr15:
57815788-57815788
GTexonicDe novononsynonymous SNVNM_032866
NM_001252335
c.G2817T
c.G2817T
p.M939I
p.M939I
11.9-Krumm2015 E
SLC9A3     11368.p1chr5:
475122-475123
AGAexonicDe novoframeshift deletionNM_001284351
NM_004174
c.2349delC
c.2376delC
p.P783fs
p.P792fs
--Krumm2015 E
AMZ2     12228.p1chr17:
66247017-66247018
GATTexonicDe novononframeshift substitutionNM_016627
NM_001033569
NM_001033570
NM_001033571
NM_001033572
NM_001289054
NM_001289056
c.366_367TT
c.366_367TT
c.366_367TT
c.366_367TT
c.366_367TT
c.366_367TT
c.366_367TT
N/A
N/A
N/A
N/A
N/A
N/A
N/A
--Krumm2015 E
CD163L1     13725.p1chr12:
7551148-7551148
CTexonicDe novononsynonymous SNVNM_001297650
NM_174941
c.G1471A
c.G1441A
p.A491T
p.A481T
13.28-Krumm2015 E
FRYL     12237.p1chr4:
48583513-48583513
CGexonicDe novononsynonymous SNVNM_015030c.G2096Cp.R699P24.42.525E-5Krumm2015 E
SLC9A3R2     11600.p1chr16:
2086460-2086460
CTexonicDe novononsynonymous SNVNM_001252073
NM_001252075
NM_001252076
NM_001130012
NM_004785
c.C217T
c.C211T
c.C217T
c.C550T
c.C550T
p.P73S
p.P71S
p.P73S
p.P184S
p.P184S
16.51-Krumm2015 E
MISP     11380.p1chr19:
757877-757878
AGAexonicDe novoframeshift deletionNM_173481c.932delGp.R311fs--Krumm2015 E
TMEM132B     11380.p1chr12:
125834485-125834486
AGAexonicDe novoframeshift deletionNM_052907c.541delGp.G181fs--Krumm2015 E
PRKCZ     14692.p1chr1:
2075646-2075646
CTintronicDe novo--Krumm2015 E
ACAP3     12687.p1chr1:
1235195-1235195
GCintronicDe novo--Krumm2015 E
ARHGEF16     11532.p1chr1:
3383909-3383909
CTintronicDe novo-2.0E-4Krumm2015 E
PRDM16     13722.p1chr1:
3322220-3322220
GCintronicDe novo--Krumm2015 E
CLSTN1     11185.p1chr1:
9795926-9795926
CAintronicDe novo--Krumm2015 E
HKDC1     13289.p1chr10:
71025396-71025396
AGexonicDe novononsynonymous SNVNM_025130c.A2428Gp.S810G15.77-Krumm2015 E
MEGF6     14139.p1chr1:
3519083-3519083
CTexonicDe novosynonymous SNVNM_001409c.G213Ap.P71P-4.287E-5Krumm2015 E
SPATA21     12740.p1chr1:
16725335-16725335
GTintronicDe novo--Krumm2015 E
CORT     11297.p1chr1:
10511663-10511663
AGUTR3De novo--Krumm2015 E
HNRNPR     12087.p1chr1:
23637301-23637301
CGexonicDe novononsynonymous SNVNM_001297621
NM_001297622
NM_001102397
NM_001102399
NM_001297620
NM_001102398
NM_005826
c.G1068C
c.G1131C
c.G1245C
c.G1254C
c.G1434C
c.G1557C
c.G1548C
p.R356S
p.R377S
p.R415S
p.R418S
p.R478S
p.R519S
p.R516S
1.23-Krumm2015 E
CELA3B     13951.p1chr1:
22313015-22313015
CTintronicDe novo-2.476E-5Krumm2015 E
RUNX3     12648.p1chr1:
25318673-25318673
GTintergenicDe novo--Krumm2015 E
GALE     13550.p1chr1:
24122974-24122974
AGintronicDe novo-8.98E-6Krumm2015 E
SPSB1     11963.p1chr1:
9427536-9427536
CTexonicDe novononsynonymous SNVNM_025106c.C724Tp.R242C24.4-Krumm2015 E
MAP3K6     12264.p1chr1:
27690724-27690724
GTexonicDe novosynonymous SNVNM_001297609
NM_004672
c.C642A
c.C666A
p.R214R
p.R222R
-8.495E-6Krumm2015 E
TMEM57     13614.p1chr1:
25810772-25810772
GAintronicDe novo--Krumm2015 E
TSSK3     14204.p1chr1:
32829410-32829410
GAexonicDe novosynonymous SNVNM_052841c.G360Ap.E120E--Krumm2015 E
GMEB1     14465.p1chr1:
29016661-29016661
AGexonicDe novosynonymous SNVNM_006582
NM_024482
c.A204G
c.A174G
p.V68V
p.V58V
--Krumm2015 E
RNF220     13572.p1chr1:
45110850-45110850
GAintronicDe novo-1.0E-4Krumm2015 E
AGO3     14282.p1chr1:
36396972-36396972
CTUTR5De novo--Krumm2015 E
ZFYVE9     11409.p1chr1:
52729428-52729428
CCCGintronicDe novo-2.0E-4Krumm2015 E
KIF2C     12671.p1chr1:
45216103-45216103
CTintronicDe novo-2.698E-5Krumm2015 E
MROH7     11354.p1chr1:
55118710-55118710
CTexonicDe novosynonymous SNVNM_001039464c.C111Tp.P37P--Krumm2015 E
SSBP3     14297.p1chr1:
54870614-54870614
GAintronicDe novo-8.829E-6Krumm2015 E
ACADM     11217.p1chr1:
76190455-76190455
GTUTR5De novo--Krumm2015 E
PATJ     11490.p1chr1:
62327208-62327208
GTintronicDe novo--Krumm2015 E
GLI4     14648.p1chr8:
144358492-144358492
GTexonicDe novononsynonymous SNVNM_138465c.G649Tp.G217C14.72-Krumm2015 E
SLC44A3     12154.p1chr1:
95356667-95356667
CTintronicDe novo--Krumm2015 E
ZNF644     12534.p1chr1:
91447920-91447920
ATUTR5De novo--Krumm2015 E
COL11A1     11552.p1chr1:
103380293-103380293
CTexonicDe novosynonymous SNVNM_080630
NM_001190709
NM_001854
NM_080629
c.G3543A
c.G3774A
c.G3891A
c.G3927A
p.G1181G
p.G1258G
p.G1297G
p.G1309G
-3.409E-5Krumm2015 E
RWDD3     12380.p1chr1:
95712390-95712390
GAexonicDe novosynonymous SNVNM_015485
NM_001278248
c.G768A
c.G723A
p.K256K
p.K241K
--Krumm2015 E
CLCC1     11838.p1chr1:
109490271-109490271
AGexonicDe novosynonymous SNVNM_001278202
NM_001278203
NM_001048210
NM_015127
c.T301C
c.T301C
c.T301C
c.T301C
p.L101L
p.L101L
p.L101L
p.L101L
--Krumm2015 E
FAM102B     13758.p1chr1:
109177766-109177766
AGexonicDe novosynonymous SNVNM_001010883c.A1077Gp.K359K--Krumm2015 E
WNT2B     11387.p1chr1:
113033611-113033613
CTGCintronicDe novo--Krumm2015 E
ATXN7L2     13072.p1chr1:
110034210-110034210
GAexonicDe novosynonymous SNVNM_153340c.G2025Ap.L675L-8.468E-6Krumm2015 E
MRPS21     12030.p1chr1:
150280647-150280647
GAexonicDe novosynonymous SNVNM_018997
NM_031901
c.G249A
c.G249A
p.P83P
p.P83P
--Krumm2015 E
NBPF25P     11129.p1chr1:
148252122-148252122
GCncRNA_intronicDe novo-5.049E-5Krumm2015 E
SETDB1     11440.p1chr1:
150902614-150902614
TCintronicDe novo--Krumm2015 E
ADAMTSL4     14316.p1chr1:
150526082-150526082
CTexonicDe novosynonymous SNVNM_001288607
NM_001288608
NM_019032
NM_025008
c.C615T
c.C615T
c.C615T
c.C615T
p.S205S
p.S205S
p.S205S
p.S205S
-1.0E-4Krumm2015 E
HRNR     12212.p1chr1:
152187191-152187191
TAexonicDe novononsynonymous SNVNM_001009931c.A6914Tp.H2305L6.052-Krumm2015 E
DDX17     12859.p1chr22:
38884082-38884082
GAexonicDe novononsynonymous SNVNM_001098504
NM_006386
c.C1486T
c.C1486T
p.P496S
p.P496S
24.0-Krumm2015 E
OAZ3     12118.p1chr1:
151742758-151742758
CTintronicDe novo-8.494E-6Krumm2015 E
S100A7     11393.p1chr1:
153430433-153430433
GAexonicDe novononsynonymous SNVNM_002963c.C155Tp.T52I0.0058.247E-6Krumm2015 E
FLG     13755.p1chr1:
152281464-152281464
AGexonicDe novosynonymous SNVNM_002016c.T5898Cp.G1966G--Krumm2015 E
MIR190B     13736.p1chr1:
154166195-154166195
AGncRNA_exonicDe novo--Krumm2015 E
NUP210L     14065.p1chr1:
154067525-154067525
CTexonicDe novosynonymous SNVNM_001159484
NM_207308
c.G2073A
c.G2073A
p.L691L
p.L691L
--Krumm2015 E
ADCY10     13939.p1chr1:
167815087-167815087
GAexonicDe novosynonymous SNVNM_001167749
NM_001297772
NM_018417
c.C2262T
c.C2445T
c.C2721T
p.H754H
p.H815H
p.H907H
-1.648E-5Krumm2015 E
VANGL2     13158.p1chr1:
160388772-160388772
TTGintronicDe novo--Krumm2015 E
C1orf112     11568.p1chr1:
169820183-169820183
GGCintronicDe novo--Krumm2015 E
ATP1B1     13309.p1chr1:
169094277-169094277
GAexonicDe novononsynonymous SNVNM_001677c.G382Ap.D128N7.2561.0E-4Krumm2015 E
LINC01031     11368.p1chr1:
194122116-194122117
ATAintergenicDe novo--Krumm2015 E