or
or
Exact

Results for "Wang2020"

Variant Events: 1850

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CLTC     85433050chr17:
57737944-57737944
CTexonicUnknownnonsynonymous SNVNM_001288653
NM_004859
c.C1174T
c.C1162T
p.P392S
p.P388S
16.8-Wang2020 T
Wang2020 T
ENO3     414368chr17:
4859960-4859960
GAexonicUnknownnonsynonymous SNVNM_001193503
NM_001976
NM_053013
c.G1031A
c.G1160A
c.G1160A
p.G344E
p.G387E
p.G387E
25.18.237E-6Wang2020 T
Wang2020 T
CASZ1     M19553chr1:
10713944-10713944
CTexonicUnknownnonsynonymous SNVNM_001079843
NM_017766
c.G2170A
c.G2170A
p.D724N
p.D724N
29.9-Wang2020 T
Wang2020 T
DDX23     81324840chr12:
49230558-49230558
GAexonicUnknownnonsynonymous SNVNM_004818c.C1030Tp.R344C21.5-Wang2020 T
Wang2020 T
CASZ1     219-2286-0001chr1:
10703326-10703326
CTexonicUnknownnonsynonymous SNVNM_001079843c.G3911Ap.R1304Q36.08.396E-6Wang2020 T
Wang2020 T
BRPF1     214222chr3:
9781122-9781122
CTexonicUnknownnonsynonymous SNVNM_001003694
NM_004634
c.C1039T
c.C1039T
p.R347C
p.R347C
20.58.263E-6Wang2020 T
Wang2020 T
PHF12     60135916chr17:
27244337-27244337
CTexonicUnknownnonsynonymous SNVNM_001033561
NM_001290131
NM_020889
c.G1100A
c.G1100A
c.G1100A
p.R367H
p.R367H
p.R367H
35.01.0E-4Wang2020 T
Wang2020 T
CASZ1     268844chr1:
10725572-10725572
GAexonicUnknownnonsynonymous SNVNM_001079843
NM_017766
c.C73T
c.C73T
p.R25C
p.R25C
20.93.0E-4Wang2020 T
Wang2020 T
NRXN1     10-05671chr2:
50765556-50765556
CTexonicUnknownnonsynonymous SNVNM_004801
NM_001135659
c.G1978A
c.G2098A
p.A660T
p.A700T
34.06.625E-5Wang2020 T
ASH1L     250_4_a.2.1chr1:
155307999-155307999
GGTexonicUnknownframeshift insertionNM_018489c.8683dupAp.T2895fs-6.66E-5Wang2020 T
Wang2020 T
ADNP     SD0091.p1chr20:
49510578-49510578
GAexonicUnknownstopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C673T
c.C673T
c.C673T
c.C673T
p.R225X
p.R225X
p.R225X
p.R225X
39.0-Wang2020 T
Wang2020 T
KMT2E     370630chr7:
104745965-104745965
GAexonicUnknownnonsynonymous SNVNM_018682
NM_182931
c.G2276A
c.G2276A
p.R759H
p.R759H
22.9-Wang2020 T
Wang2020 T
RELN     61020087chr7:
103205741-103205741
GAexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.C5194T
c.C5194T
p.L1732F
p.L1732F
27.81.648E-5Wang2020 T
RELN     8201chr7:
103205741-103205741
GAexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.C5194T
c.C5194T
p.L1732F
p.L1732F
27.81.648E-5Wang2020 T
DSCAM     86278637chr21:
41446993-41446993
CTexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.G4859A
c.G4859A
p.R1620Q
p.R1620Q
34.08.309E-6Wang2020 T
SHANK2     393327chr11:
70666591-70666591
GAexonicUnknownunknown-3.0E-4Wang2020 T
Wang2020 T
DSCAM     345299chr21:
41423968-41423968
GAexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.C5102T
c.C5102T
p.T1701M
p.T1701M
22.71.0E-4Wang2020 T
Wang2020 T
DLG4     200.03chr17:
7099824-7099824
GAexonicUnknownnonsynonymous SNVNM_001128827
NM_001365
c.C1145T
c.C1283T
p.T382M
p.T428M
22.3-Wang2020 T
Wang2020 T
KMT2A     M21730chr11:
118376815-118376815
CTexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.C10208T
c.C10199T
p.P3403L
p.P3400L
17.23-Wang2020 T
Wang2020 T
KATNAL2     286873chr18:
44625759-44625759
TAexonicUnknownnonsynonymous SNVNM_031303c.T1141Ap.Y381N20.5-Wang2020 T
Wang2020 T
ANK2     109.04chr4:
114275356-114275357
CACexonicUnknownframeshift deletionNM_001148c.5583delAp.A1861fs--Wang2020 T
Wang2020 T
CHD8     YN0006.p1chr14:
21871807-21871807
AATexonicUnknownframeshift insertionNM_001170629
NM_020920
c.3322dupA
c.2485dupA
p.I1108fs
p.I829fs
--Wang2020 T
Wang2020 T
CHD8     463.03chr14:
21896125-21896125
GAexonicUnknownnonsynonymous SNVNM_001170629
NM_020920
c.C1504T
c.C667T
p.R502C
p.R223C
15.874.141E-5Wang2020 T
Wang2020 T
ASH1L     GD0027.p1chr1:
155317506-155317506
GAexonicUnknownnonsynonymous SNVNM_018489c.C7744Tp.R2582C34.02.471E-5Wang2020 T
Wang2020 T
SETD2     474.101chr3:
47061326-47061326
GAexonicUnknownnonsynonymous SNVNM_014159c.C7355Tp.S2452L21.04.12E-5Wang2020 T
RELN     214-17011-1chr7:
103124179-103124179
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G10102A
c.G10102A
p.G3368R
p.G3368R
34.03.295E-5Wang2020 T
SLC6A1     M23713chr3:
11075334-11075334
GAexonicUnknownnonsynonymous SNVNM_003042c.G1436Ap.R479Q25.36.685E-5Wang2020 T
Wang2020 T
SHANK2     AU1644303chr11:
70805647-70805647
CTexonicUnknownunknown27.34.604E-5Wang2020 T
Wang2020 T
KMT2E     M31983chr7:
104714100-104714100
CTexonicUnknownnonsynonymous SNVNM_018682
NM_182931
c.C532T
c.C532T
p.R178C
p.R178C
24.43.363E-5Wang2020 T
Wang2020 T
KMT2A     M27791chr11:
118390432-118390432
GAexonicUnknownnonsynonymous SNVNM_001197104
NM_005933
c.G11246A
c.G11237A
p.R3749H
p.R3746H
22.94.942E-5Wang2020 T
Wang2020 T
RELN     M26918chr7:
103180699-103180699
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G6875A
c.G6875A
p.R2292H
p.R2292H
29.35.771E-5Wang2020 T
Wang2020 T
KMT2E     AU076303chr7:
104730644-104730644
CTexonicUnknownnonsynonymous SNVNM_018682
NM_182931
c.C1547T
c.C1547T
p.T516M
p.T516M
14.736.645E-5Wang2020 T
Wang2020 T
KAT6B     222_4_a.2.1chr10:
76781645-76781645
CTexonicUnknownnonsynonymous SNVNM_001256468
NM_001256469
NM_012330
c.C2479T
c.C2152T
c.C3028T
p.R827W
p.R718W
p.R1010W
13.921.655E-5Wang2020 T
KAT6B     60989928chr10:
76781645-76781645
CTexonicUnknownnonsynonymous SNVNM_001256468
NM_001256469
NM_012330
c.C2479T
c.C2152T
c.C3028T
p.R827W
p.R718W
p.R1010W
13.921.655E-5Wang2020 T
NCOR1     HEN425.p1; chr17:
15983379-15983379
CGsplicingUnknownsplicing10.338.245E-5Wang2020 T
CHAMP1     383404chr13:
115091755-115091755
GTexonicUnknownstoplossNM_001164144
NM_001164145
NM_032436
c.G2438T
c.G2438T
c.G2438T
p.X813L
p.X813L
p.X813L
4.305-Wang2020 T
HNRNPUL1     220-9854-200chr19:
41811714-41811715
CACexonicUnknownframeshift deletionNM_001301016
NM_007040
NM_144732
c.2130delA
c.2397delA
c.2097delA
p.P710fs
p.P799fs
p.P699fs
--Wang2020 T
AHDC1     GX0190.p1chr1:
27875353-27875353
AAGGAGGAGGAGGAGGAGGAGGexonicUnknownframeshift insertionNM_001029882c.3273_3274insCCTCCTCCTCCTCCTCCTCCp.F1092fs--Wang2020 T
ARID2     165_1_a.2.1chr12:
46205243-46205243
TGexonicUnknownnonsynonymous SNVNM_152641c.T327Gp.D109E14.12-Wang2020 T
ARID2     165_2_a.2.1chr12:
46205243-46205243
TGexonicUnknownnonsynonymous SNVNM_152641c.T327Gp.D109E14.12-Wang2020 T
WNT7B     63661508chr22:
46318900-46318900
GAexonicUnknownnonsynonymous SNVNM_058238c.C886Tp.R296C18.692.498E-5Wang2020 T
DSCAM     62732375chr21:
41447003-41447003
GAexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.C4849T
c.C4849T
p.R1617W
p.R1617W
19.571.659E-5Wang2020 T
DSCAM     M19708chr21:
41414453-41414453
GAexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.C5531T
c.C5531T
p.S1844L
p.S1844L
26.34.968E-5Wang2020 T
DSCAM     ASD.1340chr21:
41423896-41423896
CTexonicUnknownnonsynonymous SNVNM_001271534
NM_001389
c.G5174A
c.G5174A
p.R1725Q
p.R1725Q
36.02.493E-5Wang2020 T
ASH1L     07C62595; AGREchr1:
155308162-155308162
GAexonicUnknownnonsynonymous SNVNM_018489c.C8521Tp.R2841C17.043.299E-5Wang2020 T
SCN2A     14525.p1chr2:
166152367-166152367
GAexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G34A
c.G34A
c.G34A
p.D12N
p.D12N
p.D12N
13.34-Wang2020 T
ASH1L     372.03chr1:
155448756-155448756
CTexonicUnknownnonsynonymous SNVNM_018489c.G3905Ap.R1302Q21.31.65E-5Wang2020 T
SCN2A     ASDFI_732chr2:
166152578-166152578
AGexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.A245G
c.A245G
c.A245G
p.D82G
p.D82G
p.D82G
19.73-Wang2020 T
CACNA2D3     AU066203; Leidenchr3:
54919550-54919550
CTexonicUnknownnonsynonymous SNVNM_018398c.C1993Tp.R665C31.05.194E-5Wang2020 T
CACNA2D3     M23096; ACGCchr3:
54930847-54930847
CTexonicUnknownnonsynonymous SNVNM_018398c.C2318Tp.A773V34.0-Wang2020 T
SCN2A     220-9813-201chr2:
166170231-166170231
GAexonicUnknownnonsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G1136A
c.G1136A
c.G1136A
p.R379H
p.R379H
p.R379H
35.0-Wang2020 T
RELN     04C27821chr7:
103151311-103151311
ACexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.T8261G
c.T8261G
p.I2754S
p.I2754S
21.91.663E-5Wang2020 T
SCN2A     DEASD_0143_001chr2:
166170231-166170231
GAexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G1136A
c.G1136A
c.G1136A
p.R379H
p.R379H
p.R379H
35.0-Wang2020 T
RELN     ASD.1304chr7:
103180649-103180649
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G6925A
c.G6925A
p.D2309N
p.D2309N
31.04.131E-5Wang2020 T
CASZ1     AU2029302chr1:
10699875-10699877
GAAGAAAexonicDe novoframeshift insertionNM_001079843c.4402dupTp.F1468fs--Wang2020 T
SCN2A     10C109819chr2:
166183403-166183403
TTAexonicDe novoframeshift insertionNM_001040143
NM_001040142
NM_021007
c.2058_2059insA
c.2058_2059insA
c.2058_2059insA
p.S686fs
p.S686fs
p.S686fs
--Wang2020 T
SCN2A     14280.p1chr2:
166201311-166201311
CTexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C2809T
c.C2809T
c.C2809T
p.R937C
p.R937C
p.R937C
29.0-Wang2020 T
SCN2A     NDAR_INVTZ957VTW_wes1chr2:
166201312-166201312
GAexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G2810A
c.G2810A
c.G2810A
p.R937H
p.R937H
p.R937H
33.0-Wang2020 T
SCN2A     11892.p1chr2:
166201379-166201379
CAexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.C2877A
c.C2877A
c.C2877A
p.C959X
p.C959X
p.C959X
42.0-Wang2020 T
SCN2A     11114.p1chr2:
166210819-166210819
GTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.G3037T
c.G3037T
c.G3037T
p.G1013X
p.G1013X
p.G1013X
40.0-Wang2020 T
SCN2A     13544.p1chr2:
166231378-166231378
TCexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.T4156C
c.T4156C
c.T4156C
p.C1386R
p.C1386R
p.C1386R
15.44-Wang2020 T
SCN2A     13642.p1chr2:
166234111-166234111
CTexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C4259T
c.C4259T
c.C4259T
p.T1420M
p.T1420M
p.T1420M
28.0-Wang2020 T
SCN2A     DEASD_0262_001chr2:
166245137-166245137
ATsplicingDe novosplicing12.35-Wang2020 T
KAT6A     12108.p1chr8:
41906209-41906213
TTTTGTexonicDe novoframeshift deletionNM_001305878
NM_006766
c.283_286del
c.283_286del
p.Q95fs
p.Q95fs
--Wang2020 T
CASZ1     AU2029303chr1:
10699875-10699877
GAAGAAAexonicDe novoframeshift insertionNM_001079843c.4402dupTp.F1468fs--Wang2020 T
DDX3X     1-0554-003chrX:
41202565-41202566
ATAexonicDe novoframeshift deletionNM_001193417
NM_001193416
NM_001356
c.593delT
c.641delT
c.641delT
p.I198fs
p.I214fs
p.I214fs
--Wang2020 T
CHD8     2-1176-003chr14:
21865980-21865980
ATsplicingDe novosplicing15.92-Wang2020 T
WAC     14200.p1chr10:
28879673-28879675
CAACexonicDe novoframeshift deletionNM_016628
NM_100264
NM_100486
c.523_524del
c.388_389del
c.523_524del
p.K175fs
p.K130fs
p.K175fs
--Wang2020 T
WAC     14204.p1chr10:
28899668-28899672
AATTCAexonicDe novoframeshift deletionNM_100486
NM_016628
NM_100264
c.898_901del
c.1207_1210del
c.1072_1075del
p.I300fs
p.I403fs
p.I358fs
--Wang2020 T
HNRNPF     11043.p1chr10:
43883191-43883191
TCexonicDe novononsynonymous SNVNM_001098208
NM_001098204
NM_001098205
NM_001098206
NM_001098207
NM_004966
c.A142G
c.A142G
c.A142G
c.A142G
c.A142G
c.A142G
p.T48A
p.T48A
p.T48A
p.T48A
p.T48A
p.T48A
10.65-Wang2020 T
KMT5B     1-0466-003chr11:
67925217-67925217
AGexonicDe novononsynonymous SNVNM_001300908
NM_017635
NM_001300907
c.T1876C
c.T2596C
c.T2080C
p.S626P
p.S866P
p.S694P
20.1-Wang2020 T
KAT6B     11665.p1chr10:
76781848-76781848
CAexonicDe novononsynonymous SNVNM_001256468
NM_001256469
NM_012330
c.C2682A
c.C2355A
c.C3231A
p.D894E
p.D785E
p.D1077E
0.013-Wang2020 T
TCF7L2     13069.p1chr10:
114901076-114901076
GAsplicingDe novosplicing29.5-Wang2020 T
TCF7L2     12090.p1chr10:
114910883-114910883
GAsplicingDe novosplicing19.91-Wang2020 T
ADNP     2-0028-003chr20:
49510212-49510216
TTGACTexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.1035_1038del
c.1035_1038del
c.1035_1038del
c.1035_1038del
p.Q345fs
p.Q345fs
p.Q345fs
p.Q345fs
--Wang2020 T
SCN2A     2-0033-003chr2:
166245190-166245191
TCTexonicDe novoframeshift deletionNM_001040143
NM_001040142
NM_021007
c.4875delC
c.4875delC
c.4875delC
p.F1625fs
p.F1625fs
p.F1625fs
--Wang2020 T
AHNAK     14351.p1chr11:
62285724-62285724
CTexonicDe novononsynonymous SNVNM_001620c.G16165Ap.A5389T10.76-Wang2020 T
KMT5B     11729.p1chr11:
67926275-67926275
GAexonicDe novononsynonymous SNVNM_001300908
NM_017635
NM_001300907
c.C818T
c.C1538T
c.C1022T
p.A273V
p.A513V
p.A341V
20.51.65E-5Wang2020 T
KMT5B     11519.p1chr11:
67939039-67939039
CGexonicDe novononsynonymous SNVNM_001300909
NM_001300908
NM_016028
NM_017635
NM_001300907
c.G722C
c.G71C
c.G791C
c.G791C
c.G275C
p.W241S
p.W24S
p.W264S
p.W264S
p.W92S
26.2-Wang2020 T
SHANK2     12380.p1chr11:
70332092-70332094
CTGCexonicDe novoframeshift deletionNM_133266c.2540_2541delp.S847fs--Wang2020 T
SCN8A     7-0151-003chr12:
52200551-52200551
TCexonicDe novononsynonymous SNVNM_001177984
NM_014191
c.T5158C
c.T5281C
p.Y1720H
p.Y1761H
17.3-Wang2020 T
RELN     2-1408-004chr7:
103194122-103194122
GTexonicDe novononsynonymous SNVNM_005045
NM_173054
c.C5954A
c.C5954A
p.S1985Y
p.S1985Y
21.0-Wang2020 T
KMT2A     11145.p1chr11:
118344386-118344387
TGTexonicDe novoframeshift deletionNM_001197104
NM_005933
c.2513delG
c.2513delG
p.W838fs
p.W838fs
--Wang2020 T
CHD8     1-0559-003chr14:
21861805-21861805
GGTexonicDe novoframeshift insertionNM_001170629
NM_020920
c.6148dupA
c.5311dupA
p.T2050fs
p.T1771fs
--Wang2020 T
PHF12     AU0452303chr17:
27239841-27239841
CTexonicDe novononsynonymous SNVNM_001033561
NM_001290131
NM_020889
c.G1748A
c.G1748A
c.G1748A
p.R583Q
p.R583Q
p.R583Q
16.355.047E-5Wang2020 T
CHD8     12714.p1chr14:
21899618-21899618
GCexonicDe novostopgainNM_001170629c.C185Gp.S62X22.5-Wang2020 T
CHD8     13986.p1chr14:
21878133-21878133
GGTexonicDe novostopgainNM_001170629
NM_020920
c.2240dupA
c.1403dupA
p.Y747_L748delinsX
p.Y468_L469delinsX
--Wang2020 T
GRIN2B     12681.p1chr12:
13722953-13722953
TCsplicingDe novosplicing17.06-Wang2020 T
GRIN2B     12547.p1chr12:
13764762-13764762
CTexonicDe novostopgainNM_000834c.G1677Ap.W559X41.0-Wang2020 T
GRIN2B     13932.p1chr12:
13768560-13768560
CTexonicDe novononsynonymous SNVNM_000834c.G1367Ap.C456Y27.6-Wang2020 T
SETBP1     14012.p1chr18:
42643634-42643634
CTexonicDe novostopgainNM_015559c.C4762Tp.R1588X45.0-Wang2020 T
WAC     1-0028-003chr10:
28903529-28903531
TCATexonicDe novoframeshift deletionNM_100486
NM_016628
NM_100264
c.1163_1164del
c.1472_1473del
c.1337_1338del
p.S388fs
p.S491fs
p.S446fs
--Wang2020 T
ARID2     12910.p1chr12:
46230691-46230691
CTexonicDe novononsynonymous SNVNM_152641c.C940Tp.R314C27.1-Wang2020 T
DDX23     11223.p1chr12:
49225047-49225047
GAexonicDe novononsynonymous SNVNM_004818c.C2117Tp.A706V36.0-Wang2020 T
SPEN     AU226Achr1:
16235920-16235920
ACexonicDe novononsynonymous SNVNM_015001c.A986Cp.D329A17.83-Wang2020 T
AGO3     NDAR_INVRN099AG1_wes1chr1:
36474610-36474610
GAexonicDe novononsynonymous SNVNM_177422
NM_024852
c.G292A
c.G994A
p.G98R
p.G332R
34.0-Wang2020 T
ASXL3     2-1709-003chr18:
31324718-31324718
CTexonicDe novostopgainNM_030632c.C4906Tp.Q1636X38.0-Wang2020 T
POGZ     10C102646chr1:
151379469-151379469
GGGTACexonicDe novoframeshift insertionNM_145796
NM_207171
NM_001194938
NM_001194937
NM_015100
c.2177_2178insGTAC
c.2303_2304insGTAC
c.2276_2277insGTAC
c.2435_2436insGTAC
c.2462_2463insGTAC
p.T726fs
p.T768fs
p.T759fs
p.T812fs
p.T821fs
--Wang2020 T
ASH1L     DEASD_0085_001chr1:
155448915-155448917
TTATexonicDe novoframeshift deletionNM_018489c.3744_3745delp.H1248fs--Wang2020 T
MEF2D     DEASD_0089_001chr1:
156452417-156452417
GAexonicDe novononsynonymous SNVNM_001271629
NM_005920
c.C70T
c.C70T
p.R24W
p.R24W
20.2-Wang2020 T
CHD8     14233.p1chr14:
21859175-21859175
AATexonicDe novoframeshift insertionNM_001170629
NM_020920
c.7112dupA
c.6275dupA
p.N2371fs
p.N2092fs
--Wang2020 T
CHD8     12991.p1chr14:
21861643-21861647
TCTTCTexonicDe novoframeshift deletionNM_001170629
NM_020920
c.6307_6310del
c.5470_5473del
p.E2103fs
p.E1824fs
--Wang2020 T
CHD8     14016.p1chr14:
21870169-21870169
GAexonicDe novostopgainNM_001170629
NM_020920
c.C4009T
c.C3172T
p.R1337X
p.R1058X
36.0-Wang2020 T
CHD8     13844.p1chr14:
21871178-21871178
GAexonicDe novostopgainNM_001170629
NM_020920
c.C3712T
c.C2875T
p.Q1238X
p.Q959X
35.0-Wang2020 T
CHD8     11654.p1chr14:
21871373-21871373
TCsplicingDe novosplicing19.43-Wang2020 T
CHD8     13900.p1chr14:
21895989-21896036
ACTCTTGCACGTCCCATCACAGTAGCAAGGAGTACTCACTTGAGCTTGAexonicDe novononframeshift deletionNM_001170629
NM_020920
c.1593_1601del
c.756_764del
p.531_534del
p.252_255del
--Wang2020 T
MYT1L     DEASD_0057_001chr2:
1921023-1921023
GCexonicDe novononsynonymous SNVNM_001303052
NM_015025
c.C1572G
c.C1566G
p.H524Q
p.H522Q
19.46-Wang2020 T
MYT1L     AU062Achr2:
1926950-1926950
GTexonicDe novostopgainNM_001303052
NM_015025
c.C591A
c.C591A
p.Y197X
p.Y197X
39.0-Wang2020 T
NRXN1     DEASD_0107_001chr2:
50318536-50318536
CTexonicDe novononsynonymous SNVNM_138735
NM_004801
NM_001135659
c.G538A
c.G3643A
c.G3763A
p.V180I
p.V1215I
p.V1255I
20.1-Wang2020 T
NRXN1     NDAR_INVCG000TG1_wes1chr2:
50850511-50850511
TGexonicDe novononsynonymous SNVNM_004801
NM_001135659
c.A1075C
c.A1174C
p.N359H
p.N392H
18.45-Wang2020 T
UIMC1     AU046703chr5:
176409556-176409556
CTexonicDe novononsynonymous SNVNM_001199298
NM_016290
NM_001199297
c.G61A
c.G61A
c.G61A
p.D21N
p.D21N
p.D21N
16.27-Wang2020 T
TBR1     09C86232Achr2:
162275553-162275553
ACexonicDe novononsynonymous SNVNM_006593c.A1120Cp.N374H17.63-Wang2020 T
PACS2     12015.p1chr14:
105843213-105843213
GAexonicDe novononsynonymous SNVNM_001100913
NM_001243127
NM_015197
c.G910A
c.G685A
c.G910A
p.D304N
p.D229N
p.D304N
20.8-Wang2020 T
GABRB3     14061.p1chr15:
27017557-27017557
CTexonicDe novononsynonymous SNVNM_000814
NM_021912
c.G232A
c.G232A
p.V78I
p.V78I
18.38-Wang2020 T
SF3B1     NDAR_INVDZ305CH0_wes1chr2:
198274638-198274638
AGexonicDe novononsynonymous SNVNM_012433c.T760Cp.W254R25.0-Wang2020 T
SF3B1     NDAR_INVEW902YT9_wes1chr2:
198281565-198281565
GAexonicDe novononsynonymous SNVNM_012433c.C566Tp.A189V16.031.647E-5Wang2020 T
GIGYF2     ASDFI_1650chr2:
233704659-233704659
GAexonicDe novononsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.G2849A
c.G2867A
c.G2930A
c.G2867A
p.R950Q
p.R956Q
p.R977Q
p.R956Q
36.04.135E-5Wang2020 T
SETD5     NDAR_INVAR462JT4_wes1chr3:
9483388-9483388
CTexonicDe novostopgainNM_001080517
NM_001292043
c.C922T
c.C628T
p.R308X
p.R210X
44.0-Wang2020 T
SETD5     09C98906chr3:
9486949-9486949
GAexonicDe novononsynonymous SNVNM_001080517
NM_001292043
c.G1405A
c.G1111A
p.V469I
p.V371I
13.95-Wang2020 T
SETD5     NDAR_INVAN341TAD_wes1chr3:
9517219-9517219
GCexonicDe novononsynonymous SNVNM_001080517
NM_001292043
c.G3773C
c.G3479C
p.S1258T
p.S1160T
13.83-Wang2020 T
SLC6A1     NDAR_INVUD365NYJ_wes1chr3:
11068045-11068045
GAexonicDe novononsynonymous SNVNM_003042c.G1078Ap.G360S35.0-Wang2020 T
CSNK2A1     1-0481-003chr20:
489117-489117
CTexonicDe novononsynonymous SNVNM_001895
NM_177559
c.G79A
c.G79A
p.E27K
p.E27K
27.1-Wang2020 T
QRICH1     10C116616chr3:
49114314-49114315
TGTexonicDe novoframeshift deletionNM_198880
NM_017730
c.136delC
c.136delC
p.Q46fs
p.Q46fs
--Wang2020 T
SIN3A     14579.p1chr15:
75692422-75692422
AGexonicDe novononsynonymous SNVNM_001145357
NM_001145358
NM_015477
c.T1813C
c.T1813C
c.T1813C
p.Y605H
p.Y605H
p.Y605H
29.2-Wang2020 T
GIGYF2     13611.p1chr2:
233712061-233712061
CGexonicDe novononsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.C3446G
c.C3464G
c.C3527G
c.C3464G
p.P1149R
p.P1155R
p.P1176R
p.P1155R
23.4-Wang2020 T
CHD2     13614.p1chr15:
93563244-93563244
CTexonicDe novostopgainNM_001271c.C4909Tp.R1637X49.0-Wang2020 T
CHD2     13818.p1chr15:
93563282-93563282
TTGexonicDe novoframeshift insertionNM_001271c.4948dupGp.G1649fs--Wang2020 T
CACNA2D3     UK10K_SKUSE5080203chr3:
54872646-54872646
GTexonicDe novostopgainNM_018398c.G1522Tp.E508X38.0-Wang2020 T
NSD2     AC01-1002-01chr4:
1920309-1920310
GCGexonicDe novoframeshift deletionNM_133334
NM_001042424
NM_133335
NM_133331
NM_007331
NM_133330
c.1370delC
c.1370delC
c.1370delC
c.1370delC
c.1370delC
c.1370delC
p.A457fs
p.A457fs
p.A457fs
p.A457fs
p.A457fs
p.A457fs
--Wang2020 T
CTCF     14346.p1chr16:
67650748-67650748
CCAexonicDe novoframeshift insertionNM_001191022
NM_006565
c.70dupA
c.1054dupA
p.F23fs
p.F351fs
--Wang2020 T
CTCF     11776.p1chr16:
67660530-67660530
ACexonicDe novononsynonymous SNVNM_001191022
NM_006565
c.A446C
c.A1430C
p.H149P
p.H477P
17.66-Wang2020 T
ANK2     UK10K_SKUSE5080174chr4:
114214640-114214640
CGexonicDe novononsynonymous SNVNM_001148
NM_020977
NM_001127493
c.C2421G
c.C2421G
c.C2358G
p.I807M
p.I807M
p.I786M
19.3-Wang2020 T
ANK2     DEASD_0140_001chr4:
114254247-114254247
CTexonicDe novostopgainNM_001148
NM_020977
NM_001127493
c.C3262T
c.C3262T
c.C3235T
p.R1088X
p.R1088X
p.R1079X
43.0-Wang2020 T
ANK2     10C105731chr4:
114264189-114264189
CGexonicDe novononsynonymous SNVNM_001148
NM_020977
NM_001127493
c.C4139G
c.C4139G
c.C4112G
p.P1380R
p.P1380R
p.P1371R
24.7-Wang2020 T
NAA15     DEASD_0112_001chr4:
140262130-140262130
CGexonicDe novostopgainNM_057175c.C309Gp.Y103X36.0-Wang2020 T
NAA15     AC02-1155-01chr4:
140272765-140272765
GTexonicDe novononsynonymous SNVNM_057175c.G1014Tp.K338N21.5-Wang2020 T
NFIA     14127.p1chr1:
61818236-61818236
CTexonicDe novononsynonymous SNVNM_001134673
NM_001145511
NM_005595
NM_001145512
c.C815T
c.C791T
c.C815T
c.C950T
p.T272M
p.T264M
p.T272M
p.T317M
21.18.249E-6Wang2020 T
TRIO     UK10K_SKUSE5080162chr5:
14389434-14389435
ATAexonicDe novoframeshift deletionNM_007118c.3986delTp.I1329fs--Wang2020 T
TRIO     10C116708chr5:
14485178-14485178
GCexonicDe novononsynonymous SNVNM_007118c.G6658Cp.V2220L14.74-Wang2020 T
MEF2C     10C112390chr5:
88100432-88100432
TCexonicDe novononsynonymous SNVNM_001193348
NM_001193349
NM_001308002
NM_001193350
NM_002397
NM_001131005
NM_001193347
c.A241G
c.A241G
c.A241G
c.A241G
c.A241G
c.A241G
c.A241G
p.N81D
p.N81D
p.N81D
p.N81D
p.N81D
p.N81D
p.N81D
33.0-Wang2020 T
KMT2A     2-1005-003chr11:
118374301-118374303
CTGCexonicDe novoframeshift deletionNM_001197104
NM_005933
c.7695_7696del
c.7686_7687del
p.S2565fs
p.S2562fs
--Wang2020 T
GABRG2     AU201Achr5:
161576159-161576159
GAexonicDe novononsynonymous SNVNM_000816
NM_198904
NM_198903
c.G968A
c.G968A
c.G1088A
p.R323Q
p.R323Q
p.R363Q
36.0-Wang2020 T
ADNP     211-5367-3chr20:
49508081-49508081
ATexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.T3170A
c.T3170A
c.T3170A
c.T3170A
p.L1057X
p.L1057X
p.L1057X
p.L1057X
45.0-Wang2020 T
Wang2020 T
CHD2     215-13023-0303chr15:
93563256-93563256
CTexonicDe novostopgainNM_001271c.C4921Tp.Q1641X49.0-Wang2020 T
Wang2020 T
CHD8     220-9823-203chr14:
21876489-21876489
CTexonicUnknownnonsynonymous SNVNM_001170629
NM_020920
c.G2712A
c.G1875A
p.M904I
p.M625I
18.24-Wang2020 T
Wang2020 T
CHD8     211-5221-3chr14:
21865980-21865980
ATsplicingDe novosplicing15.92-Wang2020 T
Wang2020 T
NRXN1     217-14288-4090chr2:
50170866-50170867
AGAexonicDe novoframeshift deletionNM_138735
NM_004801
NM_001135659
c.996delC
c.4101delC
c.4311delC
p.P332fs
p.P1367fs
p.P1437fs
--Wang2020 T
Wang2020 T
PAX5     211-5583-3chr9:
37020768-37020768
AACexonicDe novoframeshift insertionNM_001280547
NM_001280548
NM_001280549
NM_001280550
NM_001280552
NM_001280553
NM_001280554
NM_001280555
NM_016734
c.76dupG
c.76dupG
c.76dupG
c.76dupG
c.76dupG
c.76dupG
c.76dupG
c.76dupG
c.76dupG
p.V26fs
p.V26fs
p.V26fs
p.V26fs
p.V26fs
p.V26fs
p.V26fs
p.V26fs
p.V26fs
-1.0E-4Wang2020 T
Wang2020 T
KANSL1     11305.p1chr17:
44248781-44248781
TGexonicDe novononsynonymous SNVNM_001193466
NM_015443
NM_001193465
c.A729C
c.A729C
c.A729C
p.Q243H
p.Q243H
p.Q243H
15.5-Wang2020 T
DLX3     13782.p1chr17:
48069119-48069119
GAexonicDe novononsynonymous SNVNM_005220c.C626Tp.S209L24.3-Wang2020 T
DLX3     11407.p1chr17:
48072206-48072206
CTexonicDe novononsynonymous SNVNM_005220c.G157Ap.G53S9.807-Wang2020 T
ZNF292     09C98975chr6:
87925717-87925717
CTexonicUnknownstopgainNM_015021c.C265Tp.R89X27.8-Wang2020 T
HNRNPR     12087.p1chr1:
23637301-23637301
CGexonicDe novononsynonymous SNVNM_001297621
NM_001297622
NM_001102397
NM_001102399
NM_001297620
NM_001102398
NM_005826
c.G1068C
c.G1131C
c.G1245C
c.G1254C
c.G1434C
c.G1557C
c.G1548C
p.R356S
p.R377S
p.R415S
p.R418S
p.R478S
p.R519S
p.R516S
1.23-Wang2020 T
KATNAL2     11008.p1chr18:
44589733-44589733
GAsplicingDe novosplicing21.7-Wang2020 T
KATNAL2     11872.p1chr18:
44603833-44603833
GCsplicingDe novosplicing16.29-Wang2020 T
RELN     AU210Achr7:
103162572-103162572
AGexonicDe novononsynonymous SNVNM_005045
NM_173054
c.T7565C
c.T7565C
p.F2522S
p.F2522S
25.2-Wang2020 T
RELN     1255JS0019chr7:
103322603-103322603
GAexonicDe novostopgainNM_005045
NM_173054
c.C1249T
c.C1249T
p.Q417X
p.Q417X
39.0-Wang2020 T
BRAF     DEASD_0164_001chr7:
140481409-140481409
ACexonicDe novononsynonymous SNVNM_004333c.T1399Gp.S467A19.26-Wang2020 T
KCNQ3     1360JS0006chr8:
133192475-133192475
GAexonicDe novononsynonymous SNVNM_001204824
NM_004519
c.C346T
c.C706T
p.R116C
p.R236C
26.4-Wang2020 T
STXBP1     09C92671chr9:
130444788-130444788
CTexonicDe novononsynonymous SNVNM_001032221
NM_003165
c.C1651T
c.C1651T
p.R551C
p.R551C
34.0-Wang2020 T
ZC3H4     11394.p1chr19:
47572583-47572583
CTexonicDe novononsynonymous SNVNM_015168c.G2164Ap.E722K14.179.825E-6Wang2020 T
ZC3H4     12600.p1chr19:
47584862-47584864
GCTGexonicDe novoframeshift deletionNM_015168c.1346_1347delp.K449fs--Wang2020 T
ZC3H4     12600.p1chr19:
47584867-47584868
CACexonicDe novoframeshift deletionNM_015168c.1342delTp.C448fs--Wang2020 T
NRXN1     1-0375-003chr2:
50733692-50733692
CTexonicDe novononsynonymous SNVNM_004801
NM_001135659
c.G2438A
c.G2558A
p.R813H
p.R853H
30.04.247E-5Wang2020 T
CSNK2A1     11097.p1chr20:
472926-472926
TCexonicDe novononsynonymous SNVNM_177560
NM_001895
NM_177559
c.A185G
c.A593G
c.A593G
p.K62R
p.K198R
p.K198R
30.0-Wang2020 T
ADNP     M27882chr20:
49510619-49510619
ATexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.T632A
c.T632A
c.T632A
c.T632A
p.L211X
p.L211X
p.L211X
p.L211X
39.0-Wang2020 T
Wang2020 T
EEF1A2     14503.p1chr20:
62120390-62120390
CTexonicDe novononsynonymous SNVNM_001958c.G1145Ap.R382H17.85-Wang2020 T
DYRK1A     13890.p1chr21:
38865466-38865466
GAsplicingDe novosplicing28.2-Wang2020 T
AHNAK     DEASD_0055_001chr11:
62297085-62297085
GAexonicDe novononsynonymous SNVNM_001620c.C4804Tp.P1602S13.01-Wang2020 T
DYRK1A     13256.p1chr21:
38877891-38877906
AGGTCTGTGCTGCTGCAexonicDe novoframeshift deletionNM_001396
NM_130436
NM_130438
NM_101395
c.1546_1546del
c.1519_1519del
c.1546_1546del
c.1546_1546del
p.G516fs
p.G507fs
p.G516fs
p.G516fs
--Wang2020 T
PHIP     7-0032-003chr6:
79770397-79770397
GAexonicDe novononsynonymous SNVNM_017934c.C328Tp.R110C21.0-Wang2020 T
DSCAM     13735.p1chr21:
41414330-41414330
AATexonicDe novoframeshift insertionNM_001271534
NM_001389
c.5653dupA
c.5653dupA
p.M1885fs
p.M1885fs
--Wang2020 T
DSCAM     12329.p1chr21:
41457527-41457527
ATsplicingDe novosplicing22.0-Wang2020 T
DSCAM     14597.p1chr21:
41457640-41457640
TTTAexonicDe novostopgainNM_001271534
NM_001389
c.4020_4021insTA
c.4020_4021insTA
p.N1341_G1342delinsX
p.N1341_G1342delinsX
--Wang2020 T
KMT5B     NDAR_INVNE346GDX_wes1chr11:
67925466-67925466
GAexonicDe novostopgainNM_001300908
NM_017635
NM_001300907
c.C1627T
c.C2347T
c.C1831T
p.R543X
p.R783X
p.R611X
40.0-Wang2020 T
KMT5B     DEASD_0109_001chr11:
67941366-67941370
CAAATCexonicDe novoframeshift deletionNM_001300909
NM_016028
NM_017635
NM_001300907
c.485_488del
c.554_557del
c.554_557del
c.38_41del
p.Y162fs
p.Y185fs
p.Y185fs
p.Y13fs
-8.28E-6Wang2020 T
HNRNPU     13896.p1chr1:
245027141-245027141
CGexonicDe novononsynonymous SNVNM_004501
NM_031844
c.G469C
c.G469C
p.G157R
p.G157R
12.79-Wang2020 T
KMT2A     1339JS0028chr11:
118344818-118344818
TAexonicDe novononsynonymous SNVNM_001197104
NM_005933
c.T2944A
c.T2944A
p.S982T
p.S982T
6.688-Wang2020 T
KMT2A     DEASD_0323_001chr11:
118360578-118360579
ACAexonicDe novoframeshift deletionNM_001197104
NM_005933
c.4552delC
c.4552delC
p.P1518fs
p.P1518fs
--Wang2020 T
MYH9     11810.p1chr22:
36684831-36684831
CTexonicDe novononsynonymous SNVNM_002473c.G4712Ap.R1571Q36.0-Wang2020 T
TNRC6B     14163.p1chr22:
40662713-40662713
CTexonicDe novostopgainNM_001162501
NM_015088
c.C2479T
c.C2479T
p.Q827X
p.Q827X
39.0-Wang2020 T
SMARCC2     1255JS0019chr12:
56566368-56566368
CAsplicingDe novosplicing18.68-Wang2020 T
NCOR1     M15225chr17:
15983379-15983379
CGsplicingDe novosplicing10.338.245E-5Wang2020 T
Wang2020 T
USP9X     13910.p1chrX:
41025217-41025217
ATexonicDe novononsynonymous SNVNM_001039590
NM_001039591
c.A2078T
c.A2078T
p.D693V
p.D693V
21.5-Wang2020 T
DDX3X     11999.p1chrX:
41204655-41204655
AGsplicingDe novosplicing16.92-Wang2020 T
NEXMIF     11290.p1chrX:
73960990-73960990
GTexonicDe novononsynonymous SNVNM_001008537c.C3402Ap.H1134Q14.881.0E-4Wang2020 T
UPF3B     11609.p1chrX:
118985815-118985815
GGAexonicDe novoframeshift insertionNM_023010
NM_080632
c.177dupT
c.177dupT
p.P60fs
p.P60fs
--Wang2020 T
CHD8     ASDFI_1077chr14:
21870652-21870652
CTexonicDe novononsynonymous SNVNM_001170629
NM_020920
c.G3725A
c.G2888A
p.R1242Q
p.R963Q
32.0-Wang2020 T
CHD8     AU036Achr14:
21876700-21876700
AGexonicDe novononsynonymous SNVNM_001170629
NM_020920
c.T2501C
c.T1664C
p.L834P
p.L555P
21.8-Wang2020 T
SCN2A     2-1337-003chr2:
166170549-166170581
GGCTGAACAGAAGGAAGCTGAATTTCAGCAGATGexonicDe novoframeshift deletionNM_001040143
NM_001040142
NM_021007
c.1315_1346del
c.1315_1346del
c.1315_1346del
p.A439fs
p.A439fs
p.A439fs
--Wang2020 T
SHANK2     1-0441-003chr11:
70336411-70336411
GAexonicDe novostopgainNM_133266c.C757Tp.R253X24.1-Wang2020 T
ZC3H4     1-0699-003chr19:
47593346-47593346
TGexonicDe novononsynonymous SNVNM_015168c.A593Cp.N198T15.83-Wang2020 T
GABRB3     DEASD_0083_001chr15:
26793067-26793068
GAGexonicDe novoframeshift deletionNM_001191320
NM_001191321
NM_000814
NM_021912
NM_001278631
c.1039delT
c.1081delT
c.1294delT
c.1294delT
c.1039delT
p.S347fs
p.S361fs
p.S432fs
p.S432fs
p.S347fs
--Wang2020 T
EEF1A2     2-1339-003chr20:
62126415-62126415
CTexonicDe novononsynonymous SNVNM_001958c.G364Ap.E122K34.0-Wang2020 T
NSD2     AU021204chr4:
1980530-1980530
CTexonicDe novononsynonymous SNVNM_001042424
NM_133335
NM_133331
NM_133330
c.C3992T
c.C3992T
c.C3992T
c.C3992T
p.A1331V
p.A1331V
p.A1331V
p.A1331V
5.3173.0E-4Wang2020 T
LEO1     08C78745chr15:
52242140-52242140
GAexonicDe novostopgainNM_001286430
NM_138792
c.C1483T
c.C1663T
p.R495X
p.R555X
36.0-Wang2020 T
SIN3A     10C116530chr15:
75684849-75684849
GAexonicDe novononsynonymous SNVNM_001145357
NM_001145358
NM_015477
c.C2585T
c.C2585T
c.C2585T
p.P862L
p.P862L
p.P862L
17.448.237E-6Wang2020 T
HNRNPF     1-0972-003chr10:
43882699-43882699
GAexonicDe novononsynonymous SNVNM_001098208
NM_001098204
NM_001098205
NM_001098206
NM_001098207
NM_004966
c.C634T
c.C634T
c.C634T
c.C634T
c.C634T
c.C634T
p.R212W
p.R212W
p.R212W
p.R212W
p.R212W
p.R212W
14.22-Wang2020 T
CHD2     10C100480chr15:
93518170-93518170
AGexonicDe novononsynonymous SNVNM_001271c.A2567Gp.D856G19.58-Wang2020 T
CHD2     DEASD_0193_001chr15:
93524620-93524620
GAexonicDe novononsynonymous SNVNM_001271c.G2999Ap.R1000Q19.26-Wang2020 T
CHD2     DEASD_0174_001chr15:
93536154-93536154
GAexonicDe novononsynonymous SNVNM_001271c.G3521Ap.G1174D35.0-Wang2020 T
TRAF7     10C102370chr16:
2226080-2226080
CTexonicDe novononsynonymous SNVNM_032271c.C1777Tp.R593W22.6-Wang2020 T
MAPK3     09C82566chr16:
30128549-30128549
CTexonicDe novononsynonymous SNVNM_001040056
NM_002746
c.G833A
c.G833A
p.R278Q
p.R278Q
36.0-Wang2020 T
PHF12     AU4412302chr17:
27244345-27244351
AGGGGGGAGGGGGGGexonicDe novoframeshift insertionNM_001033561
NM_001290131
NM_020889
c.1086dupC
c.1086dupC
c.1086dupC
p.H362fs
p.H362fs
p.H362fs
--Wang2020 T
STXBP1     2-0006-003chr9:
130444716-130444717
GCGexonicDe novoframeshift deletionNM_001032221
NM_003165
c.1580delC
c.1580delC
p.A527fs
p.A527fs
--Wang2020 T
YTHDF3     1-0169-004chr8:
64098971-64098971
TCexonicDe novounknown--Wang2020 T
VEZF1     AU187Achr17:
56060162-56060162
TGexonicDe novononsynonymous SNVNM_007146c.A626Cp.Q209P18.08-Wang2020 T
ASXL3     DEASD_0395_001chr18:
31322918-31322918
CTexonicDe novostopgainNM_030632c.C3106Tp.R1036X38.0-Wang2020 T
ASXL3     NDAR_INVLR026ZEP_wes1chr18:
31323981-31323981
CCTexonicDe novoframeshift insertionNM_030632c.4170dupTp.T1390fs--Wang2020 T
SETBP1     AU071Achr18:
42531877-42531877
GAexonicDe novononsynonymous SNVNM_015559c.G2572Ap.E858K23.4-Wang2020 T
MEIS2     2-1094-004chr15:
37242546-37242546
GAexonicDe novononsynonymous SNVNM_172315
NM_002399
NM_170674
NM_170675
NM_170676
NM_170677
NM_172316
NM_001220482
c.C917T
c.C917T
c.C956T
c.C956T
c.C956T
c.C956T
c.C692T
c.C956T
p.T306I
p.T306I
p.T319I
p.T319I
p.T319I
p.T319I
p.T231I
p.T319I
19.38-Wang2020 T
SLC6A1     2-1155-003chr3:
11067982-11067982
TCexonicDe novononsynonymous SNVNM_003042c.T1015Cp.F339L34.0-Wang2020 T
SPEN     2-1166-003chr1:
16258127-16258127
CTexonicDe novostopgainNM_015001c.C5392Tp.Q1798X41.0-Wang2020 T
ADNP     DEASD_0149_001chr20:
49508382-49508386
CCTCACexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2865_2868del
c.2865_2868del
c.2865_2868del
c.2865_2868del
p.S955fs
p.S955fs
p.S955fs
p.S955fs
--Wang2020 T
ADNP     DEASD_0076_001chr20:
49510602-49510610
CTCGGGCATCexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.641_648del
c.641_648del
c.641_648del
c.641_648del
p.N214fs
p.N214fs
p.N214fs
p.N214fs
--Wang2020 T
DYRK1A     10C108344chr21:
38877655-38877655
CTexonicDe novostopgainNM_001396
NM_130436
NM_130438
NM_101395
c.C1309T
c.C1282T
c.C1309T
c.C1309T
p.R437X
p.R428X
p.R437X
p.R437X
50.0-Wang2020 T
SCN2A     M17441chr2:
166179813-166179813
CTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.C1819T
c.C1819T
c.C1819T
p.R607X
p.R607X
p.R607X
39.08.245E-6Wang2020 T
Wang2020 T
DSCAM     AU084Achr21:
41648022-41648022
ACsplicingDe novosplicing27.3-Wang2020 T
ASH1L     M15039chr1:
155316175-155316175
CGexonicPaternalnonsynonymous SNVNM_018489c.G7889Cp.R2630T36.0-Wang2020 T
Wang2020 T
TRIP12     M19571chr2:
230650514-230650514
CTexonicPaternalnonsynonymous SNVNM_001284216
NM_001284215
NM_004238
NM_001284214
c.G4018A
c.G4927A
c.G4828A
c.G4972A
p.G1340S
p.G1643S
p.G1610S
p.G1658S
29.8-Wang2020 T
Wang2020 T
CHD2     M18930chr15:
93543766-93543766
CTexonicPaternalnonsynonymous SNVNM_001271c.C4033Tp.R1345W25.3-Wang2020 T
Wang2020 T
SCN2A