or
or
Exact

Results for "Feliciano2019"

Variant Events: 717

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ANK2     SP0020903chr4:
114254351-114254351
CTexonicDe novosynonymous SNVNM_001148
NM_020977
NM_001127493
c.C3366T
c.C3366T
c.C3339T
p.N1122N
p.N1122N
p.N1113N
0.0180.0014Feliciano2019 E
GPX6     SP0000605chr6:
28472206-28472206
GAexonicDe novounknown18.18-Feliciano2019 E
SLC28A3     SP0041645chr9:
86903067-86903067
CTexonicDe novosynonymous SNVNM_001199633
NM_022127
c.G1176A
c.G1176A
p.A392A
p.A392A
-0.0036Feliciano2019 E
GNE     SP0019306chr9:
36218241-36218241
CTexonicDe novosynonymous SNVNM_001190384
NM_001190383
NM_001190388
NM_001128227
NM_005476
c.G1542A
c.G1650A
c.G1857A
c.G1965A
c.G1872A
p.A514A
p.A550A
p.A619A
p.A655A
p.A624A
-0.0015Feliciano2019 E
REC8     SP0024054chr14:
24642348-24642348
CTexonicDe novosynonymous SNVNM_001048205
NM_005132
c.C282T
c.C282T
p.H94H
p.H94H
-0.1107Feliciano2019 E
DEPDC5     SP0030187chr22:
32229977-32229977
GAintronicDe novo-0.0994Feliciano2019 E
TRIM36     SP0041539chr5:
114480364-114480364
CTexonicDe novosynonymous SNVNM_001300752
NM_001300759
NM_018700
c.G237A
c.G666A
c.G702A
p.L79L
p.L222L
p.L234L
-0.1953Feliciano2019 E
PSAPL1     SP0048034chr4:
7435443-7435443
GAexonicDe novosynonymous SNVNM_001085382c.C1164Tp.D388D-0.1304Feliciano2019 E
NUMBL     SP0026711chr19:
41173769-41173769
GAexonicDe novosynonymous SNVNM_001289979
NM_001289980
NM_004756
c.C1311T
c.C1311T
c.C1434T
p.A437A
p.A437A
p.A478A
-0.0069Feliciano2019 E
THOP1     SP0010081chr19:
2810714-2810714
CTexonicDe novosynonymous SNVNM_003249c.C1719Tp.A573A-0.0059Feliciano2019 E
B4GALT2     SP0001571chr1:
44451234-44451234
CTexonicDe novosynonymous SNVNM_001005417
NM_003780
NM_030587
c.C909T
c.C909T
c.C996T
p.I303I
p.I303I
p.I332I
-0.0935Feliciano2019 E
SLC5A1     SP0038120chr22:
32487744-32487744
CTexonicDe novosynonymous SNVNM_001256314
NM_000343
c.C894T
c.C1275T
p.A298A
p.A425A
-0.0502Feliciano2019 E
CR1     SP0029048chr1:
207680060-207680060
TCexonicDe novosynonymous SNVNM_000573
NM_000651
c.T303C
c.T303C
p.R101R
p.R101R
0.0318.291E-6Feliciano2019 E
EML3     SP0043178chr11:
62376014-62376014
CTexonicDe novosynonymous SNVNM_001300793
NM_001300794
NM_153265
c.G1113A
c.G1110A
c.G1110A
p.A371A
p.A370A
p.A370A
12.418.264E-6Feliciano2019 E
XPC     SP0006477chr3:
14209774-14209774
CTexonicDe novosynonymous SNVNM_004628c.G519Ap.A173A-9.07E-6Feliciano2019 E
CACNA1H     SP0004175chr16:
1259413-1259413
GAsplicingDe novosplicing9.4098.984E-6Feliciano2019 E
RNF25     SP0027065chr2:
219529513-219529513
TTCexonicDe novoframeshift insertionNM_022453c.749dupGp.G250fs-8.239E-6Feliciano2019 E
TMPRSS5     SP0018069chr11:
113560999-113560999
CCGexonicDe novoframeshift insertionNM_001288749
NM_001288752
NM_001288750
NM_001288751
NM_030770
c.820dupC
c.952dupC
c.1027dupC
c.1132dupC
c.1159dupC
p.R274fs
p.R318fs
p.R343fs
p.R378fs
p.R387fs
--Feliciano2019 E
ZNF454     SP0043178chr5:
178392606-178392606
CTexonicDe novostopgainNM_001178089
NM_001178090
NM_182594
c.C1201T
c.C1201T
c.C1201T
p.R401X
p.R401X
p.R401X
34.08.262E-6Feliciano2019 E
PTPN18     SP0028464chr2:
131116972-131116972
CTexonicDe novosynonymous SNVNM_014369c.C282Tp.G94G-8.242E-6Feliciano2019 E
TSPAN4     SP0020473chr11:
865824-865824
CTexonicDe novononsynonymous SNVNM_001025238
NM_001025239
NM_001025234
NM_001025235
NM_001025236
NM_001025237
NM_003271
c.C563T
c.C371T
c.C563T
c.C563T
c.C563T
c.C563T
c.C563T
p.A188V
p.A124V
p.A188V
p.A188V
p.A188V
p.A188V
p.A188V
12.533.539E-5Feliciano2019 E
G3BP1     SP0042629chr5:
151179781-151179781
CTexonicDe novononsynonymous SNVNM_005754
NM_198395
c.C958T
c.C958T
p.R320C
p.R320C
16.442.474E-5Feliciano2019 E
ARHGAP10     SP0001890chr4:
148968201-148968201
AGexonicDe novononsynonymous SNVNM_024605c.A2026Gp.I676V0.0496.0E-4Feliciano2019 E
COL21A1     SP0018075chr6:
55929393-55929395
CCTCexonicDe novoframeshift deletionNM_030820c.2153_2154delp.Q718fs-4.0E-4Feliciano2019 E
DUS1L     SP0009232chr17:
80018579-80018579
CTexonicDe novosynonymous SNVNM_022156c.G1020Ap.P340P-9.405E-6Feliciano2019 E
ADAMTS15     SP0000753chr11:
130339155-130339155
AGsplicingDe novosplicing16.489.121E-6Feliciano2019 E
UNKL     SP0018301chr16:
1417169-1417169
TTCCCCACAGexonicDe novoframeshift insertionNM_001276414c.457_458insCTGTGGGGp.D153fs-1.451E-5Feliciano2019 E
NOC4L     SP0008074chr12:
132632522-132632522
CTexonicDe novononsynonymous SNVNM_024078c.C701Tp.A234V11.561.018E-5Feliciano2019 E
CHD8     SP0000759chr14:
21871807-21871807
AATexonicDe novoframeshift insertionNM_001170629
NM_020920
c.3322dupA
c.2485dupA
p.I1108fs
p.I829fs
--Feliciano2019 E
ZNF548     SP0000117chr19:
57909941-57909941
AATTexonicDe novoframeshift insertionNM_152909
NM_001172773
c.286_287insTT
c.322_323insTT
p.I96fs
p.I108fs
--Feliciano2019 E
TTC12     SP0000978chr11:
113210056-113210057
AGAexonicDe novoframeshift deletionNM_017868c.687delGp.K229fs--Feliciano2019 E
ABCF3     SP0000855chr3:
183907213-183907213
GAexonicDe novostopgainNM_018358c.G1095Ap.W365X35.0-Feliciano2019 E
SHANK3     SP0001367chr22:
51160866-51160866
GTsplicingDe novosplicing20.9-Feliciano2019 E
SHANK3     SP0051409chr22:
51159932-51159932
TTGexonicDe novoframeshift insertionNM_033517c.3630dupGp.L1210fs-6.0E-4Feliciano2019 E
CHCHD4     SP0047177chr3:
14163416-14163416
CAsplicingDe novosplicing2.642-Feliciano2019 E
PDE4DIP     SP0036741chr1:
144946624-144946624
CTsplicingMosaic, De novosplicing11.09-Feliciano2019 E
Feliciano2019 E
TRPM8     SP0001931chr2:
234890420-234890420
TGexonicDe novononsynonymous SNVNM_024080c.T2450Gp.L817R14.78-Feliciano2019 E
THBS1     SP0001817chr15:
39885308-39885308
CTexonicDe novostopgainNM_003246c.C2875Tp.R959X42.0-Feliciano2019 E
NBAS     SP0002235chr2:
15618415-15618415
TAsplicingDe novosplicing24.4-Feliciano2019 E
ATP6V0D2     SP0002090chr8:
87163695-87163695
GAexonicDe novononsynonymous SNVNM_152565c.G817Ap.V273I13.81-Feliciano2019 E
AKAP10     SP0001272chr17:
19835117-19835117
CTsplicingDe novosplicing15.07-Feliciano2019 E
KDM5B     SP0001272chr1:
202698891-202698891
CCAexonicDe novostopgainNM_006618
NM_001314042
c.4440dupT
c.4548dupT
p.E1481_D1482delinsX
p.E1517_D1518delinsX
--Feliciano2019 E
ADNP     SP0001740chr20:
49508976-49509001
GACCCTTGGGGTCTAAAGCTAAAACAGexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2250_2274del
c.2250_2274del
c.2250_2274del
c.2250_2274del
p.V750fs
p.V750fs
p.V750fs
p.V750fs
--Feliciano2019 E
PREX1     SP0001571chr20:
47309210-47309210
CGexonicDe novononsynonymous SNVNM_020820c.G1036Cp.A346P33.0-Feliciano2019 E
TRERF1     SP0003070chr6:
42227401-42227401
GAexonicDe novostopgainNM_001297573
NM_033502
c.C2005T
c.C1945T
p.Q669X
p.Q649X
46.0-Feliciano2019 E
TXK     SP0002657chr4:
48116418-48116418
AGexonicDe novosynonymous SNVNM_003328c.T18Cp.Y6Y--Feliciano2019 E
NBEA     SP0003496chr13:
35615208-35615208
CTexonicDe novostopgainNM_015678c.C433Tp.R145X43.0-Feliciano2019 E
CHD8     SP0003489chr14:
21899097-21899097
GAexonicDe novostopgainNM_001170629c.C706Tp.Q236X37.0-Feliciano2019 E
MAP3K15     SP0002235chrX:
19379535-19379535
TAsplicingDe novosplicing12.21-Feliciano2019 E
FBN2     SP0002235chr5:
127713510-127713511
TCTexonicDe novoframeshift deletionNM_001999c.1783delGp.D595fs--Feliciano2019 E
LYST     SP0002657chr1:
235972757-235972757
CTexonicDe novostopgainNM_000081
NM_001301365
c.G1361A
c.G1361A
p.W454X
p.W454X
40.0-Feliciano2019 E
ALDH6A1     SP0002305chr14:
74539066-74539066
GCexonicDe novononsynonymous SNVNM_001278593
NM_005589
c.C188G
c.C188G
p.A63G
p.A63G
34.0-Feliciano2019 E
SRRM2     SP0008634chr16:
2816707-2816707
CTexonicDe novostopgainNM_016333c.C6178Tp.R2060X48.0-Feliciano2019 E
RALGAPB     SP0008074chr20:
37150289-37150289
AATexonicDe novoframeshift insertionNM_001282917
NM_001282918
NM_020336
c.1568dupT
c.1568dupT
c.1568dupT
p.I523fs
p.I523fs
p.I523fs
--Feliciano2019 E
SLC15A1     SP0009287chr13:
99354735-99354735
TCexonicDe novononsynonymous SNVNM_005073c.A1465Gp.R489G11.71-Feliciano2019 E
DUOX2     SP0009120chr15:
45389513-45389513
TTAGexonicDe novoframeshift insertionNM_014080c.3769_3770insCTp.Y1257fs--Feliciano2019 E
SYNGAP1     SP0006454chr6:
33403084-33403084
TCsplicingDe novosplicing18.83-Feliciano2019 E
FAT1     SP0006235chr4:
187519280-187519280
CTsplicingDe novosplicing16.95-Feliciano2019 E
ITGA4     SP0007370chr2:
182389965-182389967
CAGCexonicDe novoframeshift deletionNM_000885c.2287_2288delp.R763fs--Feliciano2019 E
ASXL3     SP0007002chr18:
31325781-31325781
TTATCCexonicDe novoframeshift insertionNM_030632c.5969_5970insATCCp.L1990fs--Feliciano2019 E
HNMT     SP0012364chr2:
138727786-138727786
ACexonicDe novosynonymous SNVNM_001024075
NM_006895
c.A189C
c.A189C
p.A63A
p.A63A
--Feliciano2019 E
CHD8     SP0011046chr14:
21896030-21896030
GCexonicDe novosynonymous SNVNM_001170629
NM_020920
c.C1599G
c.C762G
p.L533L
p.L254L
--Feliciano2019 E
AFF3     SP0015356chr2:
100210613-100210614
CGCexonicDe novoframeshift deletionNM_001025108
NM_002285
c.1584delC
c.1509delC
p.D528fs
p.D503fs
--Feliciano2019 E
WDR20     SP0013376chr14:
102675666-102675667
ATAexonicDe novoframeshift deletionNM_001242416
NM_181308
NM_001242418
NM_144574
NM_181291
NM_001242417
c.977delT
c.977delT
c.1196delT
c.1160delT
c.1160delT
c.1253delT
p.I326fs
p.I326fs
p.I399fs
p.I387fs
p.I387fs
p.I418fs
--Feliciano2019 E
ARHGAP45     SP0009922chr19:
1085982-1085982
GTexonicDe novostopgainNM_001282334
NM_001282335
NM_001258328
NM_012292
c.G2293T
c.G3037T
c.G3436T
c.G3388T
p.E765X
p.E1013X
p.E1146X
p.E1130X
39.0-Feliciano2019 E
C6orf106     SP0009874chr6:
34574337-34574338
TGTexonicDe novostopgainNM_022758
NM_024294
c.657delC
c.855delC
p.Y219X
p.Y285X
--Feliciano2019 E
FOXP1     SP0010429chr3:
71101750-71101751
GTGexonicDe novoframeshift deletionNM_001244813
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.147delA
c.453delA
c.447delA
c.447delA
c.447delA
c.447delA
c.447delA
p.K49fs
p.K151fs
p.K149fs
p.K149fs
p.K149fs
p.K149fs
p.K149fs
--Feliciano2019 E
MYO9A     SP0010081chr15:
72190403-72190405
CTGCexonicDe novoframeshift deletionNM_006901c.4439_4440delp.T1480fs--Feliciano2019 E
ING2     SP0018345chr4:
184431954-184431956
AACAexonicDe novoframeshift deletionNM_001291959
NM_001564
c.573_574del
c.693_694del
p.E191fs
p.E231fs
--Feliciano2019 E
LZTR1     SP0018301chr22:
21348492-21348492
GTexonicDe novostopgainNM_006767c.G1549Tp.E517X43.0-Feliciano2019 E
AGPS     SP0018758chr2:
178370301-178370301
CTexonicDe novostopgainNM_003659c.C1543Tp.R515X38.0-Feliciano2019 E
DOCK8     SP0018345chr9:
370229-370229
GCsplicingDe novosplicing26.1-Feliciano2019 E
MISP     SP0016887chr19:
761662-761662
AGexonicDe novononsynonymous SNVNM_173481c.A1949Gp.E650G8.597-Feliciano2019 E
CHTF18     SP0016671chr16:
842222-842222
ATsplicingDe novosplicing12.61-Feliciano2019 E
GIGYF1     SP0017274chr7:
100284305-100284305
GAexonicDe novostopgainNM_022574c.C661Tp.R221X47.0-Feliciano2019 E
RCOR3     SP0017252chr1:
211451506-211451506
GAexonicDe novostopgainNM_018254
NM_001136223
NM_001136224
NM_001136225
c.G390A
c.G564A
c.G564A
c.G564A
p.W130X
p.W188X
p.W188X
p.W188X
36.0-Feliciano2019 E
CBX1     SP0022360chr17:
46152445-46152446
GCGexonicDe novoframeshift deletionNM_001127228
NM_006807
c.335delG
c.335delG
p.G112fs
p.G112fs
--Feliciano2019 E
SLC24A1     SP0022360chr15:
65942794-65942799
TGAAGATexonicDe novoframeshift deletionNM_001254740
NM_001301032
NM_001301031
NM_004727
NM_001301033
c.289_293del
c.2254_2258del
c.2308_2312del
c.2308_2312del
c.2254_2258del
p.E97fs
p.E752fs
p.E770fs
p.E770fs
p.E752fs
--Feliciano2019 E
CUBN     SP0022582chr10:
16882437-16882437
CTexonicDe novostopgainNM_001081c.G9924Ap.W3308X50.0-Feliciano2019 E
MRPL14     SP0022437chr6:
44081931-44081931
CCAexonicDe novoframeshift insertionNM_032111c.86dupTp.L29fs--Feliciano2019 E
FAM135A     SP0019186chr6:
71138099-71138099
CAexonicDe novostopgainNM_001162529
NM_020819
NM_001105531
c.C54A
c.C54A
c.C54A
p.Y18X
p.Y18X
p.Y18X
39.0-Feliciano2019 E
QRICH1     SP0018758chr3:
49069683-49069683
GAexonicDe novostopgainNM_198880
NM_017730
c.C2071T
c.C2071T
p.Q691X
p.Q691X
42.0-Feliciano2019 E
DMWD     SP0021004chr19:
46289770-46289771
GCGexonicDe novoframeshift deletionNM_004943c.983delGp.G328fs--Feliciano2019 E
SH3RF3     SP0020685chr2:
110049097-110049098
TCTexonicDe novoframeshift deletionNM_001099289c.1545delCp.F515fs--Feliciano2019 E
PLXNA2     SP0027605chr1:
208201505-208201505
CAsplicingDe novosplicing23.0-Feliciano2019 E
CHD3     SP0027448chr17:
7809304-7809308
TTAAGTexonicDe novononframeshift deletionNM_001005271
NM_001005273
NM_005852
c.4533_4535del
c.4356_4358del
c.4356_4358del
p.1511_1512del
p.1452_1453del
p.1452_1453del
--Feliciano2019 E
IRF2BPL     SP0028603chr14:
77492342-77492343
CGCexonicDe novoframeshift deletionNM_024496c.1793delCp.P598fs--Feliciano2019 E
CNTNAP2     SP0028519chr7:
147914427-147914427
CTexonicDe novostopgainNM_014141c.C3058Tp.Q1020X39.0-Feliciano2019 E
FOXP1     SP0026093chr3:
71019886-71019886
CCCTGTAAAGCTGCAsplicingDe novosplicing--Feliciano2019 E
HNRNPU     SP0023172chr1:
245027102-245027102
GAexonicDe novostopgainNM_004501
NM_031844
c.C508T
c.C508T
p.Q170X
p.Q170X
37.0-Feliciano2019 E
PPCS     SP0027448chr1:
42922450-42922451
GCGexonicDe novoframeshift deletionNM_001287511
NM_024664
c.215delC
c.215delC
p.A72fs
p.A72fs
--Feliciano2019 E
MEIS2     SP0026296chr15:
37385901-37385901
GAexonicDe novostopgainNM_172315
NM_002399
NM_170674
NM_170675
NM_170676
NM_170677
NM_172316
NM_001220482
c.C481T
c.C481T
c.C520T
c.C520T
c.C520T
c.C520T
c.C256T
c.C520T
p.R161X
p.R161X
p.R174X
p.R174X
p.R174X
p.R174X
p.R86X
p.R174X
40.0-Feliciano2019 E
YBX1     SP0033400chr1:
43162341-43162341
CCTexonicDe novoframeshift insertionNM_004559c.384dupTp.P128fs--Feliciano2019 E
CERS1     SP0032837chr19:
19004224-19004224
CTsplicingDe novosplicing19.47-Feliciano2019 E
SPRY1     SP0034714chr4:
124323354-124323354
CCAexonicDe novoframeshift insertionNM_001258039
NM_005841
NM_199327
NM_001258038
c.608_609insA
c.608_609insA
c.608_609insA
c.608_609insA
p.A203fs
p.A203fs
p.A203fs
p.A203fs
--Feliciano2019 E
HRAS     SP0033959chr11:
533598-533598
CCGTTTexonicDe novoframeshift insertionNM_001130442
NM_005343
NM_176795
c.304_305insAAAC
c.304_305insAAAC
c.304_305insAAAC
p.R102fs
p.R102fs
p.R102fs
--Feliciano2019 E
AGRN     SP0030765chr1:
982835-982835
GAsplicingDe novosplicing8.842-Feliciano2019 E
PCDHGA12     SP0029029chr5:
140811509-140811509
GGAexonicDe novoframeshift insertionNM_003735
NM_032094
c.1184dupA
c.1184dupA
p.E395fs
p.E395fs
--Feliciano2019 E
CELF6       SP0032712chr15:
72580647-72580647
AGsplicingDe novosplicing21.3-Feliciano2019 E
SETD1A     SP0031524chr16:
30976438-30976438
TTCexonicDe novoframeshift insertionNM_014712c.1376dupCp.S459fs--Feliciano2019 E
CLASP2     SP0039371chr3:
33648243-33648243
TCexonicDe novononsynonymous SNVNM_001207044
NM_015097
c.A835G
c.A1537G
p.M279V
p.M513V
14.53-Feliciano2019 E
SCN2A     SP0037822chr2:
166187917-166187917
ATexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.A2227T
c.A2227T
c.A2227T
p.K743X
p.K743X
p.K743X
40.0-Feliciano2019 E
MRPS28     SP0040236chr8:
80831329-80831330
CGCexonicDe novoframeshift deletionNM_014018c.449delCp.T150fs--Feliciano2019 E
MBD5     SP0039864chr2:
149227521-149227525
TCAGATexonicDe novoframeshift deletionNM_018328c.2010_2013delp.L670fs--Feliciano2019 E
TTN     SP0037023chr2:
179474028-179474028
GAexonicDe novostopgainNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.C24814T
c.C25189T
c.C25390T
c.C44305T
c.C47086T
c.C52009T
p.R8272X
p.R8397X
p.R8464X
p.R14769X
p.R15696X
p.R17337X
60.0-Feliciano2019 E
RERE     SP0034975chr1:
8716308-8716308
GAexonicDe novostopgainNM_001042681
NM_012102
c.C49T
c.C49T
p.R17X
p.R17X
41.0-Feliciano2019 E
BRSK2     SP0037695chr11:
1472606-1472607
ACAexonicDe novoframeshift deletionNM_001256627
NM_001256629
NM_001256630
NM_001282218
NM_003957
c.1502delC
c.1502delC
c.1640delC
c.1322delC
c.1502delC
p.T501fs
p.T501fs
p.T547fs
p.T441fs
p.T501fs
--Feliciano2019 E
FEZF2     SP0037344chr3:
62355946-62355947
AGAexonicDe novoframeshift deletionNM_018008c.1191delCp.A397fs--Feliciano2019 E
DPP6     SP0043850chr7:
154585859-154585859
CTexonicDe novostopgainNM_001290252
NM_001039350
NM_001936
NM_130797
c.C886T
c.C1015T
c.C1021T
c.C1207T
p.Q296X
p.Q339X
p.Q341X
p.Q403X
39.0-Feliciano2019 E
CDHR2     SP0043623chr5:
176005366-176005366
GAexonicDe novosynonymous SNVNM_001171976
NM_017675
c.G1575A
c.G1575A
p.G525G
p.G525G
--Feliciano2019 E
LIG3     SP0045640chr17:
33310570-33310570
ACexonicDe novosynonymous SNVNM_002311
NM_013975
c.A546C
c.A546C
p.A182A
p.A182A
--Feliciano2019 E
CHD2     SP0045640chr15:
93540530-93540530
GAexonicDe novostopgainNM_001271c.G3782Ap.W1261X49.0-Feliciano2019 E
MOCS3     SP0041946chr20:
49575450-49575451
TGTexonicDe novoframeshift deletionNM_014484c.72delGp.L24fs--Feliciano2019 E
NR4A2     SP0041645chr2:
157186006-157186007
GCGexonicDe novoframeshift deletionNM_006186c.692delGp.G231fs--Feliciano2019 E
POGZ     SP0042394chr1:
151378053-151378055
CCTCexonicDe novoframeshift deletionNM_145796
NM_207171
NM_001194938
NM_001194937
NM_015100
c.3171_3172del
c.3297_3298del
c.3270_3271del
c.3429_3430del
c.3456_3457del
p.T1057fs
p.T1099fs
p.T1090fs
p.T1143fs
p.T1152fs
--Feliciano2019 E
BRSK2     SP0042217chr11:
1466523-1466523
GAsplicingDe novosplicing12.1-Feliciano2019 E
CREBBP     SP0020403chr16:
3820881-3820881
GAexonicDe novononsynonymous SNVNM_001079846
NM_004380
c.C2456T
c.C2570T
p.P819L
p.P857L
21.18.24E-6Feliciano2019 E
RNF220     SP0026093chr1:
45101709-45101709
GAexonicDe novononsynonymous SNVNM_018150c.G1001Ap.G334D20.78.239E-6Feliciano2019 E
ADAMTS19     SP0024711chr5:
129015502-129015502
TCexonicDe novononsynonymous SNVNM_133638c.T2534Cp.I845T20.48.245E-6Feliciano2019 E
ITSN1     SP0007556chr21:
35258603-35258603
CTexonicDe novononsynonymous SNVNM_003024c.C4856Tp.P1619L27.98.243E-6Feliciano2019 E
TNFRSF8     SP0028519chr1:
12183819-12183819
CTexonicDe novononsynonymous SNVNM_001281430
NM_001243
c.C755T
c.C1088T
p.T252M
p.T363M
14.54-Feliciano2019 E
CNDP1     SP0045640chr18:
72244102-72244102
ACsplicingDe novosplicing9.49-Feliciano2019 E
SRGAP3     SP0001367chr3:
9055457-9055457
AGexonicDe novononsynonymous SNVNM_001033117
NM_014850
c.T1811C
c.T1883C
p.I604T
p.I628T
17.128.237E-6Feliciano2019 E
SPTBN4     SP0003228chr19:
41060209-41060209
GAexonicDe novononsynonymous SNVNM_025213
NM_020971
c.G859A
c.G4831A
p.E287K
p.E1611K
11.71-Feliciano2019 E
STK10     SP0015507chr5:
171520738-171520738
CTexonicDe novononsynonymous SNVNM_005990c.G1232Ap.R411Q11.968.267E-6Feliciano2019 E
HSF2BP     SP0006651chr21:
45050296-45050296
TCexonicDe novononsynonymous SNVNM_007031c.A481Gp.M161V13.498.266E-6Feliciano2019 E
EHBP1     SP0001272chr2:
63176110-63176110
GAexonicDe novononsynonymous SNVNM_001142614
NM_001142615
NM_001142616
NM_015252
c.G2129A
c.G2129A
c.G2129A
c.G2234A
p.C710Y
p.C710Y
p.C710Y
p.C745Y
1.1728.287E-6Feliciano2019 E
LAMA3     SP0004280chr18:
21331038-21331038
AGexonicDe novononsynonymous SNVNM_001127717
NM_001302996
NM_198129
c.A841G
c.A841G
c.A841G
p.T281A
p.T281A
p.T281A
24.48.281E-6Feliciano2019 E
ZSCAN32     SP0021852chr16:
3433002-3433002
GTexonicDe novononsynonymous SNVNM_001284529
NM_001284528
NM_017810
NM_001284527
c.C1077A
c.C1077A
c.C1308A
c.C1944A
p.F359L
p.F359L
p.F436L
p.F648L
0.5888.249E-6Feliciano2019 E
SLC26A5     SP0017106chr7:
103014907-103014907
GAexonicDe novononsynonymous SNVNM_001167962
NM_198999
c.C2078T
c.C2174T
p.S693L
p.S725L
12.298.247E-6Feliciano2019 E
TMEM175     SP0022437chr4:
946213-946213
GTexonicDe novononsynonymous SNVNM_001297424
NM_001297425
NM_001297428
NM_001297423
NM_001297427
NM_032326
NM_001297426
c.G191T
c.G191T
c.G89T
c.G191T
c.G89T
c.G437T
c.G89T
p.C64F
p.C64F
p.C30F
p.C64F
p.C30F
p.C146F
p.C30F
15.798.256E-6Feliciano2019 E
DOCK8     SP0018345chr9:
368183-368183
CGintronicDe novo9.9068.256E-6Feliciano2019 E
ATP8B3     SP0014959chr19:
1807172-1807172
CTexonicDe novononsynonymous SNVNM_001178002
NM_138813
c.G451A
c.G610A
p.D151N
p.D204N
17.668.358E-6Feliciano2019 E
STXBP2     SP0034444chr19:
7709578-7709578
GAexonicDe novononsynonymous SNVNM_001127396
NM_001272034
NM_006949
c.G1177A
c.G1219A
c.G1186A
p.A393T
p.A407T
p.A396T
4.8578.358E-6Feliciano2019 E
CDH24     SP0001494chr14:
23524818-23524818
GAexonicDe novononsynonymous SNVNM_022478
NM_144985
c.C125T
c.C125T
p.T42I
p.T42I
7.1488.566E-6Feliciano2019 E
CORO2B     SP0028603chr15:
69011138-69011138
GAexonicDe novononsynonymous SNVNM_001190456
NM_001190457
NM_006091
c.G1054A
c.G1054A
c.G1069A
p.V352M
p.V352M
p.V357M
25.28.437E-6Feliciano2019 E
PGLYRP2     SP0026334chr19:
15586538-15586538
GAexonicDe novononsynonymous SNVNM_052890c.C943Tp.R315C16.48.298E-6Feliciano2019 E
TCHH     SP0000607chr1:
152084291-152084291
CTexonicDe novononsynonymous SNVNM_007113c.G1402Ap.E468K5.5398.288E-6Feliciano2019 E
FLII     SP0026711chr17:
18155412-18155412
CTexonicDe novononsynonymous SNVNM_001256265
NM_001256264
NM_002018
c.G985A
c.G1114A
c.G1147A
p.A329T
p.A372T
p.A383T
6.0828.331E-6Feliciano2019 E
HIST1H4H     SP0028464chr6:
26285687-26285687
CGexonicDe novononsynonymous SNVNM_003543c.G41Cp.G14A17.878.314E-6Feliciano2019 E
PPP2R5C     SP0001272chr14:
102323179-102323179
GAexonicDe novononsynonymous SNVNM_002719
NM_178586
NM_178587
NM_001161725
NM_001161726
c.G251A
c.G251A
c.G251A
c.G344A
c.G416A
p.R84Q
p.R84Q
p.R84Q
p.R115Q
p.R139Q
26.21.647E-5Feliciano2019 E
VEGFB     SP0017274chr11:
64003410-64003410
CTexonicDe novononsynonymous SNVNM_001243733
NM_003377
c.C229T
c.C229T
p.R77C
p.R77C
18.669.626E-6Feliciano2019 E
NALCN     SP0011385chr13:
101763488-101763488
CTexonicDe novononsynonymous SNVNM_052867c.G2282Ap.R761H29.21.649E-5Feliciano2019 E
NEK10     SP0009898chr3:
27161295-27161295
TCexonicDe novononsynonymous SNVNM_001031741
NM_001304384
NM_152534
c.A1223G
c.A1253G
c.A3317G
p.H408R
p.H418R
p.H1106R
2.9351.649E-5Feliciano2019 E
UBAP2     SP0007188chr9:
33922728-33922728
GAexonicDe novononsynonymous SNVNM_001282530
NM_001282529
NM_018449
c.C938T
c.C2420T
c.C3221T
p.P313L
p.P807L
p.P1074L
17.729.058E-6Feliciano2019 E
CLIP2     SP0007102chr7:
73731910-73731910
CTexonicDe novononsynonymous SNVNM_003388
NM_032421
c.C34T
c.C34T
p.R12C
p.R12C
19.578.999E-6Feliciano2019 E
MEPCE     SP0033661chr7:
100028144-100028144
AGexonicDe novononsynonymous SNVNM_019606c.A503Gp.K168R21.79.39E-6Feliciano2019 E
KCNG3     SP0023136chr2:
42720400-42720400
CTexonicDe novononsynonymous SNVNM_133329
NM_172344
c.G242A
c.G242A
p.G81D
p.G81D
22.49.091E-6Feliciano2019 E
KDM2B     SP0029586chr12:
121881901-121881901
CTexonicDe novononsynonymous SNVNM_001005366
NM_032590
c.G2272A
c.G2365A
p.G758S
p.G789S
0.1141.658E-5Feliciano2019 E
KIF21B     SP0006651chr1:
200956014-200956014
GAexonicDe novononsynonymous SNVNM_001252100
NM_001252102
NM_001252103
NM_017596
c.C3647T
c.C3647T
c.C3647T
c.C3647T
p.P1216L
p.P1216L
p.P1216L
p.P1216L
23.21.657E-5Feliciano2019 E
TCHH     SP0011734chr1:
152082220-152082220
GTexonicDe novononsynonymous SNVNM_007113c.C3473Ap.P1158Q2.0751.661E-5Feliciano2019 E
NUPL2     SP0001571chr7:
23221735-23221735
CTexonicDe novononsynonymous SNVNM_007342c.C31Tp.R11W17.751.659E-5Feliciano2019 E
ITSN1     SP0005166chr21:
35144452-35144452
GAexonicDe novononsynonymous SNVNM_001001132
NM_003024
c.G1130A
c.G1130A
p.R377H
p.R377H
28.21.655E-5Feliciano2019 E
DAZAP1     SP0007121chr19:
1418211-1418211
CTexonicDe novononsynonymous SNVNM_018959
NM_170711
c.C79T
c.C79T
p.R27C
p.R27C
20.31.653E-5Feliciano2019 E
TTN     SP0020624chr2:
179425733-179425733
TGexonicDe novononsynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.A57931C
c.A58306C
c.A58507C
c.A77422C
c.A80203C
c.A85126C
p.K19311Q
p.K19436Q
p.K19503Q
p.K25808Q
p.K26735Q
p.K28376Q
13.371.657E-5Feliciano2019 E
SH3PXD2B     SP0001207chr5:
171765971-171765971
GAexonicDe novononsynonymous SNVNM_001017995c.C2138Tp.T713M1.9331.656E-5Feliciano2019 E
CBFA2T3     SP0003327chr16:
88951543-88951543
CTexonicDe novononsynonymous SNVNM_175931
NM_005187
c.G770A
c.G1028A
p.R257H
p.R343H
23.01.744E-5Feliciano2019 E
TRMT61A     SP0031073chr14:
103998955-103998955
GAexonicDe novononsynonymous SNVNM_152307c.G368Ap.R123H28.31.677E-5Feliciano2019 E
FLG     SP0033959chr1:
152281822-152281822
GAexonicDe novononsynonymous SNVNM_002016c.C5540Tp.T1847M5.8772.471E-5Feliciano2019 E
BTAF1     SP0032561chr10:
93744130-93744130
AGexonicDe novononsynonymous SNVNM_003972c.A2396Gp.N799S0.1761.913E-5Feliciano2019 E
PNMT     SP0020347chr17:
37824837-37824837
CTexonicDe novononsynonymous SNVNM_002686c.C109Tp.R37C26.41.663E-5Feliciano2019 E
FUT6     SP0023136chr19:
5832022-5832022
GAexonicDe novononsynonymous SNVNM_001040701
NM_000150
c.C557T
c.C557T
p.S186L
p.S186L
9.5061.661E-5Feliciano2019 E
SPEG     SP0040398chr2:
220354232-220354232
CTexonicDe novononsynonymous SNVNM_005876c.C8492Tp.A2831V7.1191.677E-5Feliciano2019 E
IGDCC4     SP0031728chr15:
65681184-65681184
GAexonicDe novononsynonymous SNVNM_020962c.C2669Tp.T890M18.071.669E-5Feliciano2019 E
ATP11A     SP0000406chr13:
113510373-113510373
CTexonicDe novononsynonymous SNVNM_015205
NM_032189
c.C2392T
c.C2392T
p.R798C
p.R798C
30.02.495E-5Feliciano2019 E
GALNT4     SP0031996chr12:
89916672-89916672
CTexonicDe novononsynonymous SNVNM_003774
NM_001199781
NM_001199782
c.G1655A
c.G1646A
c.G1139A
p.R552Q
p.R549Q
p.R380Q
22.12.487E-5Feliciano2019 E
WFDC3     SP0010944chr20:
44417584-44417584
CTexonicDe novononsynonymous SNVNM_080614c.G197Ap.R66Q6.2722.502E-5Feliciano2019 E
ITGB6     SP0000087chr2:
160994350-160994350
CTexonicDe novononsynonymous SNVNM_001282354
NM_001282388
NM_001282390
NM_000888
NM_001282355
NM_001282389
NM_001282353
c.G970A
c.G1129A
c.G841A
c.G1255A
c.G1255A
c.G1036A
c.G1255A
p.V324M
p.V377M
p.V281M
p.V419M
p.V419M
p.V346M
p.V419M
14.272.5E-5Feliciano2019 E
KLF5     SP0022669chr13:
73649881-73649881
GAexonicDe novononsynonymous SNVNM_001286818
NM_001730
c.G958A
c.G1231A
p.D320N
p.D411N
24.62.48E-5Feliciano2019 E
LAMA4     SP0043581chr6:
112462089-112462089
GAexonicDe novononsynonymous SNVNM_001105206
NM_001105207
NM_002290
c.C2849T
c.C2828T
c.C2828T
p.P950L
p.P943L
p.P943L
25.62.474E-5Feliciano2019 E
GLYCTK     SP0004721chr3:
52325056-52325056
GAexonicDe novononsynonymous SNVNM_001144951
NM_145262
c.G458A
c.G458A
p.R153Q
p.R153Q
9.5822.485E-5Feliciano2019 E
ZFYVE28     SP0014748chr4:
2321991-2321991
CTexonicDe novononsynonymous SNVNM_001172656
NM_001172659
NM_020972
c.G619A
c.G499A
c.G709A
p.V207M
p.V167M
p.V237M
26.92.481E-5Feliciano2019 E
ARHGAP22     SP0006823chr10:
49687793-49687793
GAexonicDe novononsynonymous SNVNM_001256026
NM_001256024
NM_001256025
NM_021226
c.C67T
c.C337T
c.C355T
c.C337T
p.R23W
p.R113W
p.R119W
p.R113W
14.83.175E-5Feliciano2019 E
ASB12     SP0037814chrX:
63445299-63445299
GAexonicDe novononsynonymous SNVNM_130388c.C232Tp.R78C20.12.861E-5Feliciano2019 E
ATN1     SP0012230chr12:
7044900-7044900
GAexonicDe novononsynonymous SNVNM_001007026
NM_001940
c.G470A
c.G470A
p.R157H
p.R157H
14.233.296E-5Feliciano2019 E
CHD3     SP0000124chr17:
7798772-7798772
GAexonicDe novononsynonymous SNVNM_001005271
NM_001005273
NM_005852
c.G1796A
c.G1619A
c.G1619A
p.R599H
p.R540H
p.R540H
14.23.295E-5Feliciano2019 E
CBFA2T3     SP0001491chr16:
88958738-88958738
GAexonicDe novononsynonymous SNVNM_175931
NM_005187
c.C277T
c.C535T
p.R93C
p.R179C
17.562.537E-5Feliciano2019 E
CELSR3     SP0004355chr3:
48680211-48680211
CTexonicDe novononsynonymous SNVNM_001407c.G8513Ap.R2838Q23.72.513E-5Feliciano2019 E
HUWE1     SP0034740chrX:
53574886-53574886
TCexonicDe novononsynonymous SNVNM_031407c.A10384Gp.I3462V13.782.612E-5Feliciano2019 E
AMPD2     SP0042217chr1:
110167952-110167952
CTexonicMosaic, De novononsynonymous SNVNM_004037
NM_139156
NM_001257360
c.C281T
c.C38T
c.C281T
p.P94L
p.P13L
p.P94L
21.32.538E-5Feliciano2019 E
Feliciano2019 E
WRN     SP0036741chr8:
31030593-31030593
CTexonicDe novononsynonymous SNVNM_000553c.C4274Tp.T1425M9.3823.333E-5Feliciano2019 E
MYO15A     SP0019630chr17:
18039887-18039887
GAexonicDe novononsynonymous SNVNM_016239c.G4666Ap.A1556T28.33.322E-5Feliciano2019 E
CERS4     SP0029048chr19:
8321590-8321590
GAexonicDe novononsynonymous SNVNM_024552c.G608Ap.R203H29.33.346E-5Feliciano2019 E
POLH     SP0018718chr6:
43550770-43550770
GAexonicDe novononsynonymous SNVNM_001291969
NM_001291970
NM_006502
c.G10A
c.G164A
c.G164A
p.V4M
p.R55H
p.R55H
36.03.336E-5Feliciano2019 E
CELSR2     SP0041645chr1:
109813168-109813168
GAexonicDe novononsynonymous SNVNM_001408c.G7429Ap.G2477S22.63.302E-5Feliciano2019 E
CYP17A1     SP0042217chr10:
104596833-104596833
GAexonicDe novononsynonymous SNVNM_000102c.C286Tp.R96W15.923.297E-5Feliciano2019 E
DTD1     SP0003070chr20:
18576856-18576856
GAexonicDe novononsynonymous SNVNM_080820c.G341Ap.R114H24.93.318E-5Feliciano2019 E
LHX4     SP0010732chr1:
180235688-180235688
GAexonicDe novononsynonymous SNVNM_033343c.G410Ap.R137Q17.693.316E-5Feliciano2019 E
KDM1B     SP0001207chr6:
18218108-18218108
GAexonicDe novononsynonymous SNVNM_153042c.G1681Ap.A561T23.14.122E-5Feliciano2019 E
TXN2     SP0037695chr22:
36876736-36876736
CTexonicDe novononsynonymous SNVNM_012473c.G149Ap.R50Q16.644.118E-5Feliciano2019 E
NADSYN1     SP0036859chr11:
71193918-71193918
CTexonicDe novononsynonymous SNVNM_018161c.C1174Tp.R392C18.34.138E-5Feliciano2019 E
CALD1     SP0022099chr7:
134645308-134645308
GAexonicDe novononsynonymous SNVNM_033140
NM_033139
NM_004342
NM_033138
NM_033157
c.G1441A
c.G1519A
c.G1459A
c.G2224A
c.G1534A
p.V481I
p.V507I
p.V487I
p.V742I
p.V512I
30.04.122E-5Feliciano2019 E
PABPN1L     SP0023723chr16:
88931278-88931278
GAexonicDe novononsynonymous SNVNM_001080487c.C637Tp.R213W12.923.432E-5Feliciano2019 E
RNH1     SP0000626chr11:
497980-497980
CTexonicDe novononsynonymous SNVNM_203384
NM_203385
NM_203388
NM_203389
NM_002939
NM_203383
NM_203386
NM_203387
c.G1118A
c.G1118A
c.G1118A
c.G1118A
c.G1118A
c.G1118A
c.G1118A
c.G1118A
p.R373Q
p.R373Q
p.R373Q
p.R373Q
p.R373Q
p.R373Q
p.R373Q
p.R373Q
6.3983.361E-5Feliciano2019 E
PRLH     SP0004355chr2:
238475287-238475287
GAexonicDe novononsynonymous SNVNM_015893c.G71Ap.R24H4.5883.61E-5Feliciano2019 E
APC2     SP0019700chr19:
1460797-1460797
CTexonicMosaic, De novononsynonymous SNVNM_005883c.C1462Tp.R488C17.823.44E-5Feliciano2019 E
Feliciano2019 E
PRAM1     SP0011385chr19:
8563155-8563155
GAexonicDe novononsynonymous SNVNM_032152c.C1451Tp.S484L16.184.904E-5Feliciano2019 E
HSPBP1     SP0035025chr19:
55789166-55789166
GAexonicDe novononsynonymous SNVNM_001297600
NM_012267
NM_001130106
c.C397T
c.C259T
c.C259T
p.R133W
p.R87W
p.R87W
19.284.889E-5Feliciano2019 E
PRG4     SP0006667chr1:
186281999-186281999
GAexonicDe novononsynonymous SNVNM_001127710
NM_001127709
NM_001127708
NM_001303232
NM_005807
c.G3688A
c.G3811A
c.G3967A
c.G3961A
c.G4090A
p.G1230S
p.G1271S
p.G1323S
p.G1321S
p.G1364S
19.894.946E-5Feliciano2019 E
FER1L6     SP0001491chr8:
125094635-125094635
GAexonicDe novononsynonymous SNVNM_001039112c.G4327Ap.D1443N35.04.944E-5Feliciano2019 E
SERPINB7     SP0001995chr18:
61471670-61471670
GAexonicDe novononsynonymous SNVNM_001261831
NM_001040147
NM_001261830
NM_003784
c.G893A
c.G944A
c.G944A
c.G944A
p.R298H
p.R315H
p.R315H
p.R315H
14.64.143E-5Feliciano2019 E
SLC26A4     SP0000972chr7:
107323684-107323684
AGexonicDe novononsynonymous SNVNM_000441c.A803Gp.N268S23.84.139E-5Feliciano2019 E
HS6ST1     SP0002974chr2:
129025783-129025783
GAexonicDe novononsynonymous SNVNM_004807c.C1189Tp.R397C15.744.633E-5Feliciano2019 E
PTPRU     SP0036288chr1:
29631340-29631340
CTexonicDe novononsynonymous SNVNM_001195001
NM_133177
NM_133178
NM_005704
c.C2722T
c.C2722T
c.C2722T
c.C2752T
p.R908W
p.R908W
p.R908W
p.R918W
19.64.272E-5Feliciano2019 E
MOB3B     SP0037814chr9:
27455451-27455451
CTexonicDe novononsynonymous SNVNM_024761c.G98Ap.R33Q14.296.59E-5Feliciano2019 E
ZP3     SP0003489chr7:
76054396-76054396
GAexonicDe novononsynonymous SNVNM_001110354c.G115Ap.V39I8.1296.351E-5Feliciano2019 E
PAMR1     SP0015379chr11:
35492253-35492253
CTexonicDe novononsynonymous SNVNM_001001991
NM_015430
NM_001282675
c.G608A
c.G608A
c.G488A
p.R203Q
p.R203Q
p.R163Q
19.776.591E-5Feliciano2019 E
HSD17B2     SP0038333chr16:
82101832-82101832
CTexonicDe novononsynonymous SNVNM_002153c.C323Tp.T108M11.376.59E-5Feliciano2019 E
PLEKHM1     SP0010944chr17:
43531356-43531356
CTexonicDe novononsynonymous SNVNM_014798c.G1862Ap.R621Q10.835.041E-5Feliciano2019 E
NAGLU     SP0018069chr17:
40689451-40689451
AGexonicDe novononsynonymous SNVNM_000263c.A419Gp.Y140C25.44.947E-5Feliciano2019 E
CUL7     SP0046673chr6:
43020439-43020439
CTexonicDe novononsynonymous SNVNM_001168370
NM_014780
c.G244A
c.G88A
p.V82M
p.V30M
20.45.814E-5Feliciano2019 E
TBC1D10B     SP0023444chr16:
30370100-30370100
GAexonicDe novononsynonymous SNVNM_015527c.C1681Tp.R561C17.055.637E-5Feliciano2019 E
POTEC     SP0042592chr18:
14522353-14522353
CTexonicDe novononsynonymous SNVNM_001137671c.G1309Ap.A437T5.1551.0E-4Feliciano2019 E
HAUS6     SP0024794chr9:
19080631-19080631
GAexonicDe novononsynonymous SNVNM_001270890
NM_017645
c.C910T
c.C910T
p.L304F
p.L304F
17.771.0E-4Feliciano2019 E
CNTRL     SP0031728chr9:
123935966-123935966
GAexonicDe novononsynonymous SNVNM_007018c.G6698Ap.R2233H15.831.0E-4Feliciano2019 E
TIPARP     SP0016887chr3:
156422507-156422507
CTexonicDe novononsynonymous SNVNM_001184717
NM_001184718
NM_015508
c.C1561T
c.C1561T
c.C1561T
p.R521C
p.R521C
p.R521C
15.921.0E-4Feliciano2019 E
AP5Z1     SP0028260chr7:
4825249-4825249
CTexonicDe novononsynonymous SNVNM_014855c.C1066Tp.R356W14.537.278E-5Feliciano2019 E
ECT2L     SP0039355chr6:
139175261-139175261
GAexonicDe novononsynonymous SNVNM_001195037
NM_001077706
c.G1168A
c.G1168A
p.V390M
p.V390M
15.726.642E-5Feliciano2019 E
UTP11     SP0036966chr1:
38483420-38483420
AGexonicDe novononsynonymous SNVNM_016037c.A206Gp.K69R13.319.923E-5Feliciano2019 E
SERPINA5     SP0046854chr14:
95053760-95053760
CTexonicDe novononsynonymous SNVNM_000624c.C61Tp.R21C13.268.32E-5Feliciano2019 E
TUB     SP0018345chr11:
8111646-8111646
ACexonicDe novononsynonymous SNVNM_177972
NM_003320
c.A121C
c.A286C
p.K41Q
p.K96Q
27.43.0E-4Feliciano2019 E
TREH     SP0001365chr11:
118530506-118530506
CTexonicDe novounknown12.343.0E-4Feliciano2019 E
TEDC1     SP0041178chr14:
105965066-105965066
CTexonicDe novononsynonymous SNVNM_001134876
NM_001134875
NM_001134877
NM_001198983
c.C965T
c.C1064T
c.C842T
c.C848T
p.P322L
p.P355L
p.P281L
p.P283L
9.4757.0E-4Feliciano2019 E
CPZ     SP0020948chr4:
8621112-8621112
GAexonicDe novononsynonymous SNVNM_003652
NM_001014447
NM_001014448
c.G1694A
c.G1727A
c.G1316A
p.R565H
p.R576H
p.R439H
33.04.0E-4Feliciano2019 E
PHF14     SP0001365chr7:
11030426-11030426
GAexonicDe novononsynonymous SNVNM_014660c.G997Ap.A333T13.292.0E-4Feliciano2019 E
LRP4     SP0032848chr11:
46880739-46880739
CTexonicDe novononsynonymous SNVNM_002334c.G5513Ap.R1838Q23.71.0E-4Feliciano2019 E
ARID1A     SP0034419chr1:
27023808-27023808
CTexonicDe novononsynonymous SNVNM_006015
NM_139135
c.C914T
c.C914T
p.A305V
p.A305V
14.03.0E-4Feliciano2019 E
ALS2CL     SP0000854chr3:
46728480-46728480
AGexonicDe novononsynonymous SNVNM_001190707
NM_147129
c.T527C
c.T527C
p.I176T
p.I176T
6.4563.0E-4Feliciano2019 E
ADCY10     SP0000665chr1:
167849419-167849419
TCexonicDe novononsynonymous SNVNM_001167749
NM_001297772
NM_018417
c.A691G
c.A874G
c.A1150G
p.I231V
p.I292V
p.I384V
9.994-Feliciano2019 E
ZIM2     SP0000404chr19:
57286414-57286414
TCexonicDe novononsynonymous SNVNM_015363
NM_001146326
NM_001146327
c.A1226G
c.A1226G
c.A1226G
p.E409G
p.E409G
p.E409G
10.37-Feliciano2019 E
SOCS7     SP0000978chr17:
36508386-36508386
CTexonicDe novononsynonymous SNVNM_014598c.C259Tp.P87S