or
or
Exact

Results for "Ruzzo2019"

Variant Events: 6209

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
AP1G2     iHART1894chr14:
24031571-24031573
CATCexonicPaternalframeshift deletionNM_001282474
NM_001282475
NM_003917
c.409_410del
c.1336_1337del
c.1552_1553del
p.M137fs
p.M446fs
p.M518fs
-3.295E-5Ruzzo2019 G
AP1G2     iHART1891chr14:
24031571-24031573
CATCexonicPaternalframeshift deletionNM_001282474
NM_001282475
NM_003917
c.409_410del
c.1336_1337del
c.1552_1553del
p.M137fs
p.M446fs
p.M518fs
-3.295E-5Ruzzo2019 G
DHRS2     iHART1880chr14:
24108211-24108212
TGTexonicPaternalframeshift deletionNM_005794
NM_182908
c.139delG
c.139delG
p.G47fs
p.G47fs
-4.978E-5Ruzzo2019 G
DHRS2     iHART1557chr14:
24105983-24105983
TGsplicingPaternalsplicing--Ruzzo2019 G
NGDN     iHART1362chr14:
23944467-23944467
GTexonicMaternalstopgainNM_001042635
NM_015514
c.G232T
c.G232T
p.G78X
p.G78X
32.02.0E-4Ruzzo2019 G
MYH7     iHART1972chr14:
23897831-23897831
GAexonicMaternalstopgainNM_000257c.C1456Tp.Q486X40.0-Ruzzo2019 G
NGDN     iHART1360chr14:
23944467-23944467
GTexonicMaternalstopgainNM_001042635
NM_015514
c.G232T
c.G232T
p.G78X
p.G78X
32.02.0E-4Ruzzo2019 G
NGDN     iHART1361chr14:
23944467-23944467
GTexonicMaternalstopgainNM_001042635
NM_015514
c.G232T
c.G232T
p.G78X
p.G78X
32.02.0E-4Ruzzo2019 G
GMPR2     iHART2900chr14:
24705317-24705318
CGCexonicPaternalframeshift deletionNM_001283022
NM_001283023
NM_016576
NM_001002000
NM_001002001
NM_001002002
NM_001283021
c.491delG
c.353delG
c.491delG
c.437delG
c.437delG
c.437delG
c.329delG
p.R164fs
p.R118fs
p.R164fs
p.R146fs
p.R146fs
p.R146fs
p.R110fs
-1.0E-4Ruzzo2019 G
GMPR2     iHART2902chr14:
24705317-24705318
CGCexonicPaternalframeshift deletionNM_001283022
NM_001283023
NM_016576
NM_001002000
NM_001002001
NM_001002002
NM_001283021
c.491delG
c.353delG
c.491delG
c.437delG
c.437delG
c.437delG
c.329delG
p.R164fs
p.R118fs
p.R164fs
p.R146fs
p.R146fs
p.R146fs
p.R110fs
-1.0E-4Ruzzo2019 G
TGM1     iHART3242chr14:
24729019-24729019
TCsplicingPaternalsplicing18.373.0E-4Ruzzo2019 G
TGM1     iHART3240chr14:
24729019-24729019
TCsplicingPaternalsplicing18.373.0E-4Ruzzo2019 G
IPO4     iHART2431chr14:
24653612-24653613
ACAexonicPaternalframeshift deletionNM_024658c.1648delGp.V550fs--Ruzzo2019 G
PCK2     iHART3002chr14:
24567595-24567595
GGGCTGTGGATGAGAexonicPaternalframeshift insertionNM_001018073
NM_001291556
NM_001308054
NM_004563
c.459_460insGCTGTGGATGAGA
c.57_58insGCTGTGGATGAGA
c.57_58insGCTGTGGATGAGA
c.459_460insGCTGTGGATGAGA
p.Q153fs
p.Q19fs
p.Q19fs
p.Q153fs
-6.694E-5Ruzzo2019 G
GMPR2     iHART2903chr14:
24705317-24705318
CGCexonicPaternalframeshift deletionNM_001283022
NM_001283023
NM_016576
NM_001002000
NM_001002001
NM_001002002
NM_001283021
c.491delG
c.353delG
c.491delG
c.437delG
c.437delG
c.437delG
c.329delG
p.R164fs
p.R118fs
p.R164fs
p.R146fs
p.R146fs
p.R146fs
p.R110fs
-1.0E-4Ruzzo2019 G
TSSK4     iHART1112chr14:
24676320-24676320
ACsplicingPaternalsplicing14.21.668E-5Ruzzo2019 G
CBLN3     iHART3032chr14:
24898050-24898050
GAexonicMaternalstopgainNM_001039771c.C211Tp.R71X39.03.042E-5Ruzzo2019 G
RIPK3     iHART2506chr14:
24805599-24805599
GAexonicMaternalstopgainNM_006871c.C1339Tp.R447X20.61.0E-4Ruzzo2019 G
COCH     iHART1876chr14:
31355086-31355090
AAGCTAexonicPaternalframeshift deletionNM_001135058
NM_004086
c.1046_1049del
c.1046_1049del
p.K349fs
p.K349fs
-8.254E-6Ruzzo2019 G
GZMB     iHART2106chr14:
25101153-25101153
GAexonicPaternalstopgainNM_004131c.C511Tp.R171X12.418.236E-6Ruzzo2019 G
DHRS1     iHART2774chr14:
24765956-24765956
ATexonicMaternalstopgainNM_001136050
NM_138452
c.T282A
c.T282A
p.Y94X
p.Y94X
35.0-Ruzzo2019 G
DHRS1     iHART2772chr14:
24765956-24765956
ATexonicMaternalstopgainNM_001136050
NM_138452
c.T282A
c.T282A
p.Y94X
p.Y94X
35.0-Ruzzo2019 G
RIPK3     iHART2507chr14:
24805599-24805599
GAexonicMaternalstopgainNM_006871c.C1339Tp.R447X20.61.0E-4Ruzzo2019 G
ADCY4     iHART2633chr14:
24787892-24787893
TGTexonicMaternalframeshift deletionNM_001198568
NM_001198592
NM_139247
c.3048delC
c.3048delC
c.3048delC
p.R1016fs
p.R1016fs
p.R1016fs
-1.648E-5Ruzzo2019 G
PNN     iHART2845chr14:
39650999-39650999
CTexonicPaternalstopgainNM_002687c.C2086Tp.R696X37.0-Ruzzo2019 G
SEC23A     iHART2585chr14:
39514528-39514529
ACAsplicingPaternalsplicing--Ruzzo2019 G
MIA2       iHART2323chr14:
39716607-39716607
CTexonicPaternalstopgainNM_054024c.C829Tp.Q277X13.09-Ruzzo2019 G
MIA2       iHART2322chr14:
39716607-39716607
CTexonicPaternalstopgainNM_054024c.C829Tp.Q277X13.09-Ruzzo2019 G
MIPOL1     iHART2155chr14:
37838804-37838804
AAAAACAATCAAGAACGTGCTexonicPaternalframeshift insertionNM_138731
NM_001195296
NM_001195297
c.911_912insAAACAATCAAGAACGTGCT
c.911_912insAAACAATCAAGAACGTGCT
c.911_912insAAACAATCAAGAACGTGCT
p.E304fs
p.E304fs
p.E304fs
-1.657E-5Ruzzo2019 G
MIPOL1     iHART2154chr14:
37838804-37838804
AAAAACAATCAAGAACGTGCTexonicPaternalframeshift insertionNM_138731
NM_001195296
NM_001195297
c.911_912insAAACAATCAAGAACGTGCT
c.911_912insAAACAATCAAGAACGTGCT
c.911_912insAAACAATCAAGAACGTGCT
p.E304fs
p.E304fs
p.E304fs
-1.657E-5Ruzzo2019 G
SEC23A     iHART2584chr14:
39514528-39514529
ACAsplicingPaternalsplicing--Ruzzo2019 G
SEC23A     iHART2587chr14:
39514528-39514529
ACAsplicingPaternalsplicing--Ruzzo2019 G
TOGARAM1     iHART1624chr14:
45481239-45481239
ATexonicMaternalstopgainNM_001308120
NM_015091
c.A3199T
c.A3199T
p.K1067X
p.K1067X
41.01.661E-5Ruzzo2019 G
C14orf28     iHART1532chr14:
45370163-45370164
GTGsplicingPaternalsplicing-3.513E-5Ruzzo2019 G
TOGARAM1     iHART2778chr14:
45535867-45535869
GCTGexonicMaternalframeshift deletionNM_015091
NM_001308120
c.4488_4489del
c.4647_4648del
p.G1496fs
p.G1549fs
--Ruzzo2019 G
TOGARAM1     iHART2777chr14:
45535867-45535869
GCTGexonicMaternalframeshift deletionNM_015091
NM_001308120
c.4488_4489del
c.4647_4648del
p.G1496fs
p.G1549fs
--Ruzzo2019 G
MIA2       iHART2730chr14:
39716691-39716692
CACexonicMaternalframeshift deletionNM_054024c.914delAp.Q305fs-4.137E-5Ruzzo2019 G
MIA2       iHART2731chr14:
39716691-39716692
CACexonicMaternalframeshift deletionNM_054024c.914delAp.Q305fs-4.137E-5Ruzzo2019 G
MIA2       iHART2127chr14:
39717264-39717264
GTexonicMaternalstopgainNM_054024c.G1486Tp.E496X18.51.727E-5Ruzzo2019 G
MIA2       iHART2261chr14:
39716859-39716859
GGAexonicPaternalframeshift insertionNM_054024c.1082dupAp.E361fs-7.486E-5Ruzzo2019 G
RPL36AL     iHART1192chr14:
50085801-50085801
GAexonicMaternalstopgainNM_001001c.C22Tp.R8X19.144.181E-5Ruzzo2019 G
LRR1     iHART2550chr14:
50074401-50074401
TTAexonicPaternalframeshift insertionNM_152329c.567dupAp.I189fs-1.648E-5Ruzzo2019 G
L2HGDH     iHART3126chr14:
50769619-50769619
CTsplicingMaternalsplicing25.61.647E-5Ruzzo2019 G
POLE2     iHART3295chr14:
50130049-50130049
GGCTexonicPaternalframeshift insertionNM_001197330
NM_001197331
NM_002692
c.660_661insAG
c.738_739insAG
c.738_739insAG
p.P221fs
p.P247fs
p.P247fs
--Ruzzo2019 G
MDGA2     iHART1905chr14:
48143825-48143829
GGGTAGUTR5Paternal--Ruzzo2019 G
MDGA2     iHART1901chr14:
48143825-48143829
GGGTAGUTR5Paternal--Ruzzo2019 G
LRR1     iHART2549chr14:
50074401-50074401
TTAexonicPaternalframeshift insertionNM_152329c.567dupAp.I189fs-1.648E-5Ruzzo2019 G
MDGA2     iHART2726chr14:
48143988-48143988
CCCACACACTCATGCACAAACACACTCAUTR5Maternal--Ruzzo2019 G
PYGL     iHART2303chr14:
51381418-51381418
CAsplicingMaternalsplicing24.68.251E-6Ruzzo2019 G
PYGL     iHART2305chr14:
51381418-51381418
CAsplicingMaternalsplicing24.68.251E-6Ruzzo2019 G
NID2     iHART2949chr14:
52473253-52473253
AACCsplicingMaternalsplicing-1.649E-5Ruzzo2019 G
NID2     iHART2948chr14:
52473253-52473253
AACCsplicingMaternalsplicing-1.649E-5Ruzzo2019 G
NIN     iHART2474chr14:
51224702-51224702
GAexonicPaternalstopgainNM_020921
NM_182944
NM_182946
c.C3046T
c.C3046T
c.C3046T
p.Q1016X
p.Q1016X
p.Q1016X
38.0-Ruzzo2019 G
L2HGDH     iHART3127chr14:
50769619-50769619
CTsplicingMaternalsplicing25.61.647E-5Ruzzo2019 G
ABHD12B     iHART1448chr14:
51347189-51347189
CCGexonicPaternalframeshift insertionNM_181814
NM_001206673
c.125dupG
c.356dupG
p.R42fs
p.R119fs
--Ruzzo2019 G
NIN     iHART2473chr14:
51224702-51224702
GAexonicPaternalstopgainNM_020921
NM_182944
NM_182946
c.C3046T
c.C3046T
c.C3046T
p.Q1016X
p.Q1016X
p.Q1016X
38.0-Ruzzo2019 G
WDHD1     iHART1034chr14:
55434063-55434064
CACexonicPaternalframeshift deletionNM_001008396
NM_007086
c.1743delT
c.2112delT
p.P581fs
p.P704fs
--Ruzzo2019 G
WDHD1     iHART2472chr14:
55429761-55429761
CAexonicPaternalstopgainNM_001008396
NM_007086
c.G2071T
c.G2440T
p.E691X
p.E814X
42.0-Ruzzo2019 G
WDHD1     iHART2219chr14:
55454070-55454070
GCexonicPaternalstopgainNM_001008396
NM_007086
c.C1193G
c.C1562G
p.S398X
p.S521X
41.0-Ruzzo2019 G
WDHD1     iHART2222chr14:
55454070-55454070
GCexonicPaternalstopgainNM_001008396
NM_007086
c.C1193G
c.C1562G
p.S398X
p.S521X
41.0-Ruzzo2019 G
CGRRF1     iHART1375chr14:
55004530-55004530
CTexonicPaternalstopgainNM_006568c.C661Tp.Q221X38.08.614E-6Ruzzo2019 G
STYX     iHART3127chr14:
53217446-53217446
CTexonicPaternalstopgainNM_145251
NM_001130701
c.C190T
c.C190T
p.R64X
p.R64X
26.5-Ruzzo2019 G
WDHD1     iHART2564chr14:
55411082-55411082
GAexonicPaternalstopgainNM_001008396
NM_007086
c.C2788T
c.C3157T
p.R930X
p.R1053X
42.01.0E-4Ruzzo2019 G
WDHD1     iHART2565chr14:
55411082-55411082
GAexonicPaternalstopgainNM_001008396
NM_007086
c.C2788T
c.C3157T
p.R930X
p.R1053X
42.01.0E-4Ruzzo2019 G
TOMM20L     iHART1183chr14:
58874125-58874127
AACAexonicPaternalframeshift deletionNM_207377c.345_346delp.K115fs-2.0E-4Ruzzo2019 G
SLC35F4     iHART3103chr14:
58038738-58038738
CAsplicingMaternalsplicing25.3-Ruzzo2019 G
KIAA0586     iHART1824chr14:
58923419-58923419
GCsplicingMaternalsplicing9.4477.866E-5Ruzzo2019 G
KIAA0586     iHART1618chr14:
58895075-58895075
TTCexonicMaternalframeshift insertionNM_014749
NM_001244189
NM_001244190
c.94dupC
c.130dupC
c.49dupC
p.D31fs
p.D43fs
p.D16fs
-3.0E-4Ruzzo2019 G
TMEM260     iHART2666chr14:
57084016-57084016
GTsplicingPaternalsplicing15.458.581E-6Ruzzo2019 G
TMEM260     iHART2023chr14:
57075927-57075927
GAexonicPaternalstopgainNM_017799c.G740Ap.W247X38.0-Ruzzo2019 G
SLC35F4     iHART3107chr14:
58038738-58038738
CAsplicingMaternalsplicing25.3-Ruzzo2019 G
TMEM260     iHART2665chr14:
57084016-57084016
GTsplicingPaternalsplicing15.458.581E-6Ruzzo2019 G
RHOJ     iHART1884chr14:
63747854-63747854
GTsplicingPaternalsplicing31.08.521E-6Ruzzo2019 G
RHOJ     iHART1883chr14:
63747854-63747854
GTsplicingPaternalsplicing31.08.521E-6Ruzzo2019 G
SYNE2     iHART2352chr14:
64416725-64416725
GAsplicingMaternalsplicing22.68.281E-6Ruzzo2019 G
SYNE2     iHART2355chr14:
64416725-64416725
GAsplicingMaternalsplicing22.68.281E-6Ruzzo2019 G
CCDC175     iHART3265chr14:
60011900-60011900
TAexonicMaternalstopgainNM_001164399c.A1153Tp.K385X18.1-Ruzzo2019 G
CCDC175     iHART2618chr14:
59998585-59998589
TCTTCTexonicPaternalframeshift deletionNM_001164399c.1663_1666delp.E555fs--Ruzzo2019 G
TMEM30B     iHART1897chr14:
61747313-61747313
GGCexonicPaternalframeshift insertionNM_001017970c.552dupGp.P185fs--Ruzzo2019 G
SIX4     iHART1672chr14:
61180136-61180136
GAexonicPaternalstopgainNM_017420c.C2335Tp.Q779X35.0-Ruzzo2019 G
PPP1R36     iHART2446chr14:
65019554-65019554
CTexonicPaternalstopgainNM_172365c.C157Tp.Q53X10.039.065E-5Ruzzo2019 G
PPP1R36     iHART2445chr14:
65019554-65019554
CTexonicPaternalstopgainNM_172365c.C157Tp.Q53X10.039.065E-5Ruzzo2019 G
PPP1R36     iHART2748chr14:
65032338-65032343
TTTCAGTsplicingMaternalsplicing-2.521E-5Ruzzo2019 G
PPP1R36     iHART2747chr14:
65032338-65032343
TTTCAGTsplicingMaternalsplicing-2.521E-5Ruzzo2019 G
SYNE2     iHART2383chr14:
64691211-64691213
GGTGexonicMaternalframeshift deletionNM_182910
NM_182913
NM_015180
NM_182914
c.982_983del
c.1360_1361del
c.20347_20348del
c.20416_20417del
p.V328fs
p.V454fs
p.V6783fs
p.V6806fs
--Ruzzo2019 G
SYNE2     iHART2382chr14:
64691211-64691213
GGTGexonicMaternalframeshift deletionNM_182910
NM_182913
NM_015180
NM_182914
c.982_983del
c.1360_1361del
c.20347_20348del
c.20416_20417del
p.V328fs
p.V454fs
p.V6783fs
p.V6806fs
--Ruzzo2019 G
ZBTB1     iHART1274chr14:
64988862-64988862
CTexonicDe novononsynonymous SNVNM_001123329
NM_014950
c.C640T
c.C640T
p.R214W
p.R214W
16.49-Ruzzo2019 G
ESR2     iHART1256chr14:
64735552-64735552
GAexonicMaternalstopgainNM_001214902
NM_001271876
NM_001271877
NM_001040275
NM_001291723
NM_001437
NM_001291712
c.C613T
c.C613T
c.C613T
c.C613T
c.C613T
c.C613T
c.C613T
p.R205X
p.R205X
p.R205X
p.R205X
p.R205X
p.R205X
p.R205X
41.08.247E-6Ruzzo2019 G
SUSD6     iHART2799chr14:
70171319-70171319
AGsplicingMaternalsplicing20.4-Ruzzo2019 G
ZFYVE26     iHART2550chr14:
68271996-68272006
CCTGAGGAGCTCexonicPaternalframeshift deletionNM_015346c.1199_1208delp.E400fs--Ruzzo2019 G
SLC10A1     iHART3007chr14:
70245940-70245944
CAGAACexonicPaternalframeshift deletionNM_003049c.701_704delp.F234fs-1.759E-5Ruzzo2019 G
SLC10A1     iHART3005chr14:
70245940-70245944
CAGAACexonicPaternalframeshift deletionNM_003049c.701_704delp.F234fs-1.759E-5Ruzzo2019 G
PLEKHH1     iHART1848chr14:
68043197-68043201
TGATGTexonicMaternalframeshift deletionNM_020715c.2439_2442delp.L813fs--Ruzzo2019 G
PLEK2     iHART1692chr14:
67859496-67859506
GGCCAGGGTCAGexonicMaternalframeshift deletionNM_016445c.542_551delp.V181fs--Ruzzo2019 G
ZFYVE26     iHART2549chr14:
68271996-68272006
CCTGAGGAGCTCexonicPaternalframeshift deletionNM_015346c.1199_1208delp.E400fs--Ruzzo2019 G
VTI1B     iHART1571chr14:
68141191-68141192
CGCexonicPaternalframeshift deletionNM_006370c.15delCp.A5fs--Ruzzo2019 G
HEATR4     iHART1921chr14:
73989290-73989292
TTCTexonicPaternalframeshift deletionNM_203309
NM_001220484
c.565_566del
c.565_566del
p.E189fs
p.E189fs
-1.655E-5Ruzzo2019 G
HEATR4     iHART1768chr14:
73980858-73980866
TCTCACCCATexonicMaternalframeshift deletionNM_203309
NM_001220484
c.1283_1290del
c.1283_1290del
p.V428fs
p.V428fs
--Ruzzo2019 G
FAM161B     iHART1532chr14:
74401014-74401014
TTAexonicPaternalframeshift insertionNM_152445c.2077_2078insTp.K693fs-8.238E-6Ruzzo2019 G
FAM161B     iHART1531chr14:
74401014-74401014
TTAexonicPaternalframeshift insertionNM_152445c.2077_2078insTp.K693fs-8.238E-6Ruzzo2019 G
SLC10A1     iHART2188chr14:
70246026-70246030
CAGAGCexonicMaternalframeshift deletionNM_003049c.615_618delp.L205fs-4.99E-5Ruzzo2019 G
SLC10A1     iHART3004chr14:
70245940-70245944
CAGAACexonicPaternalframeshift deletionNM_003049c.701_704delp.F234fs-1.759E-5Ruzzo2019 G
DCAF4     iHART1257chr14:
73420965-73420965
GCexonicDe novononsynonymous SNVNM_181341
NM_181340
NM_001163508
NM_001163509
NM_015604
c.G722C
c.G602C
c.G905C
c.G839C
c.G902C
p.S241T
p.S201T
p.S302T
p.S280T
p.S301T
24.0-Ruzzo2019 G
SLC10A1     iHART1025chr14:
70263834-70263839
GGTGAAGexonicMaternalframeshift deletionNM_003049c.34_38delp.F12fs-2.527E-5Ruzzo2019 G
PROX2     iHART1221chr14:
75329942-75329953
TCCTTGCTGGTATexonicMaternalframeshift deletionNM_001080408
NM_001243007
c.585_595del
c.585_595del
p.G195fs
p.G195fs
-8.365E-6Ruzzo2019 G
NPC2     iHART1866chr14:
74953141-74953141
TAsplicingMaternalsplicing24.3-Ruzzo2019 G
EIF2B2     iHART2837chr14:
75470384-75470384
GTexonicPaternalstopgainNM_014239c.G415Tp.E139X34.0-Ruzzo2019 G
PROX2     iHART1220chr14:
75329942-75329953
TCCTTGCTGGTATexonicMaternalframeshift deletionNM_001080408
NM_001243007
c.585_595del
c.585_595del
p.G195fs
p.G195fs
-8.365E-6Ruzzo2019 G
BBOF1     iHART2988chr14:
74523936-74523937
CACexonicMaternalframeshift deletionNM_025057c.1554delAp.P518fs--Ruzzo2019 G
BBOF1     iHART2023chr14:
74514653-74514654
GAGexonicMaternalframeshift deletionNM_025057c.669delAp.R223fs-3.0E-4Ruzzo2019 G
NPC2     iHART1862chr14:
74953141-74953141
TAsplicingMaternalsplicing24.3-Ruzzo2019 G
ABCD4     iHART2751chr14:
74763050-74763050
GTexonicPaternalstopgainNM_005050c.C528Ap.Y176X17.81.648E-5Ruzzo2019 G
SAMD15     iHART3114chr14:
77845254-77845254
CGexonicMaternalstopgainNM_001010860c.C1493Gp.S498X36.08.252E-6Ruzzo2019 G
POMT2     iHART2688chr14:
77751891-77751891
GAexonicPaternalstopgainNM_013382c.C1417Tp.R473X40.02.471E-5Ruzzo2019 G
ISM2     iHART2788chr14:
77941964-77941964
GAexonicMaternalstopgainNM_199296c.C1690Tp.Q564X27.4-Ruzzo2019 G
SAMD15     iHART3116chr14:
77845254-77845254
CGexonicMaternalstopgainNM_001010860c.C1493Gp.S498X36.08.252E-6Ruzzo2019 G
FLVCR2     iHART3183chr14:
76100028-76100029
TGTexonicPaternalframeshift deletionNM_001195283
NM_017791
c.395delG
c.1010delG
p.W132fs
p.W337fs
-8.236E-6Ruzzo2019 G
JDP2     iHART1220chr14:
75904733-75904734
ACAexonicPaternalstopgainNM_001135047
NM_001135048
NM_001135049
NM_130469
c.111delC
c.111delC
c.144delC
c.111delC
p.Y37X
p.Y37X
p.Y48X
p.Y37X
--Ruzzo2019 G
IFT43     iHART2150chr14:
76549590-76549591
ACAexonicMaternalframeshift deletionNM_052873
NM_001102564
c.481delC
c.466delC
p.L161fs
p.L156fs
--Ruzzo2019 G
TTLL5     iHART2704chr14:
76241851-76241851
CTexonicPaternalstopgainNM_015072c.C2161Tp.R721X41.0-Ruzzo2019 G
SPATA7     iHART1730chr14:
88903921-88903926
CAAAATCexonicPaternalframeshift deletionNM_001040428
NM_018418
c.1100_1104del
c.1196_1200del
p.Q367fs
p.Q399fs
--Ruzzo2019 G
GPR65     iHART1416chr14:
88477554-88477555
GTGexonicMaternalframeshift deletionNM_003608c.364delTp.F122fs-1.649E-5Ruzzo2019 G
EML5     iHART1403chr14:
89110776-89110776
CAsplicingPaternalsplicing19.46-Ruzzo2019 G
EML5     iHART1401chr14:
89110776-89110776
CAsplicingPaternalsplicing19.46-Ruzzo2019 G
NRXN3     iHART1908chr14:
79269981-79269981
AGexonicDe novononsynonymous SNVNM_004796c.A944Gp.Y315C17.58-Ruzzo2019 G
C14orf178     iHART1536chr14:
78235822-78235823
CTCexonicPaternalframeshift deletionNM_001173978
NM_174943
c.81delT
c.171delT
p.A27fs
p.A57fs
-3.0E-4Ruzzo2019 G
GALC     iHART2017chr14:
88429779-88429779
GCexonicPaternalstopgainNM_001201401
NM_000153
NM_001201402
c.C1041G
c.C1110G
c.C1032G
p.Y347X
p.Y370X
p.Y344X
17.284.975E-5Ruzzo2019 G
TSHR     iHART1108chr14:
81610620-81610620
GTexonicPaternalstopgainNM_000369c.G2218Tp.E740X37.0-Ruzzo2019 G
SLC24A4     iHART2991chr14:
92949044-92949044
ATexonicPaternalstopgainNM_153646
NM_153648
NM_153647
c.A1276T
c.A1084T
c.A1219T
p.K426X
p.K362X
p.K407X
39.0-Ruzzo2019 G
TC2N     iHART2489chr14:
92251698-92251698
GGAexonicPaternalframeshift insertionNM_001289134
NM_001128595
NM_001128596
NM_152332
c.977dupT
c.1169dupT
c.1169dupT
c.1169dupT
p.F326fs
p.F390fs
p.F390fs
p.F390fs
-1.0E-4Ruzzo2019 G
MOAP1     iHART2424chr14:
93650561-93650561
CTexonicPaternalstopgainNM_022151c.G27Ap.W9X36.0-Ruzzo2019 G
LGMN     iHART1807chr14:
93180231-93180231
CGsplicingMaternalsplicing13.111.648E-5Ruzzo2019 G
NRDE2     iHART2788chr14:
90769212-90769212
GCexonicMaternalstopgainNM_017970c.C1263Gp.Y421X40.0-Ruzzo2019 G
EFCAB11     iHART2899chr14:
90263615-90263615
GTexonicDe novononsynonymous SNVNM_001284267
NM_001284269
NM_145231
c.C320A
c.C392A
c.C464A
p.A107D
p.A131D
p.A155D
24.0-Ruzzo2019 G
TC2N     iHART2490chr14:
92251698-92251698
GGAexonicPaternalframeshift insertionNM_001289134
NM_001128595
NM_001128596
NM_152332
c.977dupT
c.1169dupT
c.1169dupT
c.1169dupT
p.F326fs
p.F390fs
p.F390fs
p.F390fs
-1.0E-4Ruzzo2019 G
CATSPERB     iHART1829chr14:
92174572-92174572
CCTexonicPaternalframeshift insertionNM_024764c.378dupAp.A127fs--Ruzzo2019 G
SERPINA12     iHART1424chr14:
94953688-94953689
TATexonicMaternalframeshift deletionNM_001304461
NM_173850
c.1196delT
c.1196delT
p.I399fs
p.I399fs
-8.248E-6Ruzzo2019 G
SERPINA9     iHART2424chr14:
94935677-94935678
GTGexonicPaternalframeshift deletionNM_001284275
NM_175739
NM_001284276
c.446delA
c.554delA
c.107delA
p.N149fs
p.N185fs
p.N36fs
-6.624E-5Ruzzo2019 G
ATG2B     iHART1880chr14:
96773170-96773170
GAexonicMaternalstopgainNM_018036c.C4387Tp.Q1463X50.08.261E-6Ruzzo2019 G
SERPINA12     iHART2211chr14:
94962709-94962709
CAsplicingPaternalsplicing10.919.892E-5Ruzzo2019 G
UNC79     iHART3145chr14:
94088960-94088960
CCAGexonicMaternalframeshift insertionNM_020818c.4850_4851insAGp.A1617fs--Ruzzo2019 G
UNC79     iHART3144chr14:
94088960-94088960
CCAGexonicMaternalframeshift insertionNM_020818c.4850_4851insAGp.A1617fs--Ruzzo2019 G
SERPINA1     iHART2782chr14:
94844884-94844884
CCGexonicPaternalframeshift insertionNM_000295
NM_001002235
NM_001127700
NM_001127702
NM_001127706
NM_001127707
NM_001002236
NM_001127701
NM_001127703
NM_001127704
NM_001127705
c.1158dupC
c.1158dupC
c.1158dupC
c.1158dupC
c.1158dupC
c.1158dupC
c.1158dupC
c.1158dupC
c.1158dupC
c.1158dupC
c.1158dupC
p.E387fs
p.E387fs
p.E387fs
p.E387fs
p.E387fs
p.E387fs
p.E387fs
p.E387fs
p.E387fs
p.E387fs
p.E387fs
-4.947E-5Ruzzo2019 G
ASB2     iHART2627chr14:
94405855-94405855
GGGCexonicMaternalframeshift insertionNM_016150
NM_001202429
c.1071_1072insGC
c.1215_1216insGC
p.L358fs
p.L406fs
-3.703E-5Ruzzo2019 G
EXOC3L4     iHART1818chr14:
103566765-103566766
AGAexonicPaternalframeshift deletionNM_001077594c.210delGp.K70fs-1.86E-5Ruzzo2019 G
TECPR2     iHART1145chr14:
102898366-102898367
CTCexonicPaternalframeshift deletionNM_001172631
NM_014844
c.1319delT
c.1319delT
p.L440fs
p.L440fs
-7.174E-5Ruzzo2019 G
TDRD9     iHART2473chr14:
104431789-104431789
CAexonicPaternalstopgainNM_153046c.C540Ap.C180X17.23-Ruzzo2019 G
TDRD9     iHART2474chr14:
104431789-104431789
CAexonicPaternalstopgainNM_153046c.C540Ap.C180X17.23-Ruzzo2019 G
HHIPL1     iHART2855chr14:
100111546-100111546
TTGGCCCexonicMaternalframeshift insertionNM_001127258
NM_032425
c.2_3insGGCCC
c.2_3insGGCCC
p.M1fs
p.M1fs
--Ruzzo2019 G
ATG2B     iHART1879chr14:
96773170-96773170
GAexonicMaternalstopgainNM_018036c.C4387Tp.Q1463X50.08.261E-6Ruzzo2019 G
ZNF839     iHART2820chr14:
102798097-102798097
CTexonicPaternalstopgainNM_001267827
NM_001267828
NM_018335
c.C982T
c.C982T
c.C1330T
p.Q328X
p.Q328X
p.Q444X
13.99-Ruzzo2019 G
SLC25A29     iHART2516chr14:
100758890-100758892
CTTCexonicMaternalframeshift deletionNM_152333
NM_001039355
NM_001291813
NM_001291814
c.442_443del
c.640_641del
c.442_443del
c.442_443del
p.K148fs
p.K214fs
p.K148fs
p.K148fs
--Ruzzo2019 G
MKRN3     iHART3081chr15:
23812277-23812277
CTexonicMaternalstopgainNM_005664c.C1348Tp.R450X37.0-Ruzzo2019 G
NUDT14     iHART2918chr14:
105642925-105642926
TCTexonicMaternalframeshift deletionNM_177533c.373delGp.E125fs-1.689E-5Ruzzo2019 G
OCA2     iHART1754chr15:
28261317-28261317
TTGAexonicMaternalframeshift insertionNM_000275
NM_001300984
c.822_823insTC
c.822_823insTC
p.T275fs
p.T275fs
-1.0E-4Ruzzo2019 G
NPAP1     iHART1327chr15:
24923265-24923265
CCAGexonicPaternalframeshift insertionNM_018958c.2251_2252insAGp.Q751fs--Ruzzo2019 G
ASPG     iHART2186chr14:
104552118-104552122
CGGTGCexonicMaternalframeshift deletionNM_001080464c.12_15delp.A4fs--Ruzzo2019 G
ASPG     iHART2188chr14:
104552118-104552122
CGGTGCexonicMaternalframeshift deletionNM_001080464c.12_15delp.A4fs--Ruzzo2019 G
NUDT14     iHART2916chr14:
105642925-105642926
TCTexonicMaternalframeshift deletionNM_177533c.373delGp.E125fs-1.689E-5Ruzzo2019 G
PLD4     iHART3047chr14:
105398084-105398084
GAsplicingPaternalsplicing12.455.0E-4Ruzzo2019 G
AVEN     iHART2268chr15:
34331244-34331244
GAexonicPaternalstopgainNM_020371c.C4Tp.Q2X36.0-Ruzzo2019 G
RYR3     iHART1183chr15:
33999177-33999177
GTexonicMaternalstopgainNM_001036
NM_001243996
c.G6541T
c.G6541T
p.G2181X
p.G2181X
49.0-Ruzzo2019 G
CHRM5     iHART1672chr15:
34355339-34355339
ATexonicPaternalstopgainNM_012125c.A421Tp.K141X41.0-Ruzzo2019 G
CHRM5     iHART1480chr15:
34338740-34338740
GAsplicingPaternalsplicing--Ruzzo2019 G
TRPM1     iHART3297chr15:
31318341-31318341
CAsplicingPaternalsplicing13.388.329E-6Ruzzo2019 G
FAM189A1     iHART1383chr15:
29429241-29429241
GAexonicMaternalstopgainNM_015307c.C787Tp.Q263X17.61-Ruzzo2019 G
TRPM1     iHART2564chr15:
31355320-31355320
CTsplicingMaternalsplicing28.4-Ruzzo2019 G
TRPM1     iHART2565chr15:
31355320-31355320
CTsplicingMaternalsplicing28.4-Ruzzo2019 G
FSIP1     iHART3201chr15:
40056058-40056059
ATAexonicPaternalframeshift deletionNM_152597c.522delAp.K174fs-2.517E-5Ruzzo2019 G
FSIP1     iHART3050chr15:
39909979-39909979
TTCACexonicMaternalstopgainNM_152597c.1655_1656insGTGp.E552delinsEX--Ruzzo2019 G
GPR176     iHART1268chr15:
40093961-40093961
CTexonicMaternalstopgainNM_001271855
NM_007223
NM_001271854
c.G785A
c.G920A
c.G917A
p.W262X
p.W307X
p.W306X
37.0-Ruzzo2019 G
GPR176     iHART1271chr15:
40093961-40093961
CTexonicMaternalstopgainNM_001271855
NM_007223
NM_001271854
c.G785A
c.G920A
c.G917A
p.W262X
p.W307X
p.W306X
37.0-Ruzzo2019 G
KATNBL1     iHART2507chr15:
34440831-34440832
ACAsplicingMaternalsplicing--Ruzzo2019 G
CHRM5     iHART1374chr15:
34356466-34356468
GAAGexonicMaternalframeshift deletionNM_012125c.1549_1550delp.K517fs-1.664E-5Ruzzo2019 G
DPH6     iHART3167chr15:
35746972-35746976
TAGTCTexonicPaternalframeshift deletionNM_080650c.358_361delp.D120fs-4.146E-5Ruzzo2019 G
DPH6     iHART3168chr15:
35746972-35746976
TAGTCTexonicPaternalframeshift deletionNM_080650c.358_361delp.D120fs-4.146E-5Ruzzo2019 G
KNSTRN     iHART2816chr15:
40682073-40682074
CTCexonicMaternalframeshift deletionNM_001142761
NM_001142762
NM_033286
c.629delT
c.629delT
c.629delT
p.L210fs
p.L210fs
p.L210fs
-1.0E-4Ruzzo2019 G
KNSTRN     iHART2815chr15:
40682073-40682074
CTCexonicMaternalframeshift deletionNM_001142761
NM_001142762
NM_033286
c.629delT
c.629delT
c.629delT
p.L210fs
p.L210fs
p.L210fs
-1.0E-4Ruzzo2019 G
ZFYVE19     iHART1747chr15:
41099938-41099946
GGTGAGGGTGexonicMaternalframeshift deletionNM_001077268
NM_001258420
c.152_159del
c.152_159del
p.G51fs
p.G51fs
--Ruzzo2019 G
DNAJC17     iHART1571chr15:
41060234-41060234
GTexonicPaternalstopgainNM_018163c.C819Ap.Y273X10.11-Ruzzo2019 G
EIF2AK4     iHART2554chr15:
40324995-40324995
CAexonicPaternalstopgainNM_001013703c.C4766Ap.S1589X42.0-Ruzzo2019 G
EIF2AK4     iHART1583chr15:
40284388-40284388
CTexonicPaternalstopgainNM_001013703c.C2644Tp.Q882X41.0-Ruzzo2019 G
DISP2     iHART2533chr15:
40660010-40660010
GAexonicPaternalstopgainNM_033510c.G1697Ap.W566X38.0-Ruzzo2019 G
DISP2     iHART2532chr15:
40660010-40660010
GAexonicPaternalstopgainNM_033510c.G1697Ap.W566X38.0-Ruzzo2019 G
JMJD7     iHART2988chr15:
42128344-42128344
AGsplicingPaternalsplicing20.71.0E-4Ruzzo2019 G
RPAP1     iHART1457chr15:
41828413-41828413
GAexonicPaternalstopgainNM_015540c.C334Tp.R112X28.42.0E-4Ruzzo2019 G
PLA2G4B     iHART2116chr15:
42135893-42135893
CTexonicPaternalstopgainNM_001114633
NM_001198588
NM_005090
c.C763T
c.C1456T
c.C1456T
p.R255X
p.R486X
p.R486X
37.02.0E-4Ruzzo2019 G
JMJD7     iHART2989chr15:
42128344-42128344
AGsplicingPaternalsplicing20.71.0E-4Ruzzo2019 G
SPINT1     iHART2681chr15:
41145331-41145332
TCTexonicMaternalframeshift deletionNM_001032367
NM_003710
NM_181642
c.486delC
c.486delC
c.486delC
p.I162fs
p.I162fs
p.I162fs
-2.477E-5Ruzzo2019 G
SPINT1     iHART2682chr15:
41145331-41145332
TCTexonicMaternalframeshift deletionNM_001032367
NM_003710
NM_181642
c.486delC
c.486delC
c.486delC
p.I162fs
p.I162fs
p.I162fs
-2.477E-5Ruzzo2019 G
LTK     iHART2768chr15:
41799363-41799363
CCAexonicPaternalframeshift insertionNM_001135685
NM_206961
NM_002344
c.1171dupT
c.1287dupT
c.1470dupT
p.W391fs
p.G430fs
p.G491fs
--Ruzzo2019 G
EXD1     iHART2424chr15:
41483774-41483775
CACexonicMaternalframeshift deletionNM_152596
NM_001286441
c.555delT
c.729delT
p.D185fs
p.D243fs
--Ruzzo2019 G
SPTBN5     iHART2605chr15:
42149458-42149458
GAexonicPaternalstopgainNM_016642c.C8599Tp.Q2867X48.01.938E-5Ruzzo2019 G
SPTBN5     iHART3044chr15:
42146337-42146337
GAexonicPaternalstopgainNM_016642c.C9685Tp.Q3229X50.06.561E-5Ruzzo2019 G
SPTBN5     iHART1424chr15:
42158097-42158097
AACexonicPaternalframeshift insertionNM_016642c.6826dupGp.V2276fs-3.603E-5Ruzzo2019 G
SPTBN5     iHART2791chr15:
42158044-42158044
GAexonicMaternalstopgainNM_016642c.C6880Tp.R2294X46.03.88E-5Ruzzo2019 G
SPTBN5     iHART1237chr15:
42142117-42142117
GGCTGAexonicMaternalframeshift insertionNM_016642c.10961_10962insTCAGp.S3654fs-1.0E-4Ruzzo2019 G
PLA2G4B     iHART2334chr15:
42139532-42139533
CACsplicingMaternalsplicing-7.0E-4Ruzzo2019 G
SPTBN5     iHART3300chr15:
42145779-42145779
CTsplicingPaternalsplicing12.04-Ruzzo2019 G
SPTBN5     iHART3298chr15:
42145779-42145779
CTsplicingPaternalsplicing12.04-Ruzzo2019 G
VPS39     iHART2298chr15:
42454229-42454229
CTsplicingMaternalsplicing19.63-Ruzzo2019 G
SPTBN5     iHART1268chr15:
42185746-42185746
TCsplicingMaternalsplicing--Ruzzo2019 G
GANC     iHART1443chr15:
42602479-42602479
AGsplicingMaternalsplicing19.833.375E-5Ruzzo2019 G
GANC     iHART2458chr15:
42600418-42600418
AGsplicingMaternalsplicing12.196.6E-5Ruzzo2019 G
SPTBN5     iHART1880chr15:
42171591-42171591
GAexonicPaternalstopgainNM_016642c.C3049Tp.R1017X40.04.424E-5Ruzzo2019 G
SPTBN5     iHART1327chr15:
42160302-42160304
ACTAexonicMaternalframeshift deletionNM_016642c.6170_6171delp.E2057fs--Ruzzo2019 G
SPTBN5     iHART1271chr15:
42185746-42185746
TCsplicingMaternalsplicing--Ruzzo2019 G
SPTBN5     iHART1879chr15:
42171591-42171591
GAexonicPaternalstopgainNM_016642c.C3049Tp.R1017X40.04.424E-5Ruzzo2019 G
STARD9     iHART3059chr15:
42977441-42977442
CTCexonicPaternalframeshift deletionNM_020759c.3666delTp.P1222fs--Ruzzo2019 G
STARD9     iHART3060chr15:
42977441-42977442
CTCexonicPaternalframeshift deletionNM_020759c.3666delTp.P1222fs--Ruzzo2019 G
STARD9     iHART2355chr15:
42979405-42979405
ATexonicPaternalstopgainNM_020759c.A5629Tp.K1877X40.02.0E-4Ruzzo2019 G
STARD9     iHART3249chr15:
42978929-42978933
CCCTTCexonicMaternalframeshift deletionNM_020759c.5154_5157delp.A1718fs-4.958E-5Ruzzo2019 G
GANC     iHART2274chr15:
42618611-42618612
TGTexonicPaternalframeshift deletionNM_198141c.1410delGp.V470fs-1.647E-5Ruzzo2019 G
GANC     iHART2272chr15:
42618611-42618612
TGTexonicPaternalframeshift deletionNM_198141c.1410delGp.V470fs-1.647E-5Ruzzo2019 G
STARD9     iHART1168chr15:
42943213-42943213
GCsplicingPaternalsplicing20.25.218E-5Ruzzo2019 G
GANC     iHART2934chr15:
42640309-42640309
GGTexonicMaternalframeshift insertionNM_198141c.2314dupTp.V771fs-1.663E-5Ruzzo2019 G
STARD9     iHART2523chr15:
43010331-43010331
CCCAGAexonicMaternalframeshift insertionNM_020759c.13716_13717insCAGAp.I4572fs-5.729E-5Ruzzo2019 G
STARD9     iHART1462chr15:
43010203-43010203
CCTTTAexonicPaternalframeshift insertionNM_020759c.13588_13589insTTTAp.L4530fs--Ruzzo2019 G
STARD9     iHART3216chr15:
43010631-43010631
AGsplicingMaternalsplicing15.15-Ruzzo2019 G
STARD9     iHART2522chr15:
43010331-43010331
CCCAGAexonicMaternalframeshift insertionNM_020759c.13716_13717insCAGAp.I4572fs-5.729E-5Ruzzo2019 G
STARD9     iHART1277chr15:
42982195-42982195
GGAexonicPaternalframeshift insertionNM_020759c.8420dupAp.E2807fs--Ruzzo2019 G
STARD9     iHART2352chr15:
42979405-42979405
ATexonicPaternalstopgainNM_020759c.A5629Tp.K1877X40.02.0E-4Ruzzo2019 G
STARD9     iHART1461chr15:
43010203-43010203
CCTTTAexonicPaternalframeshift insertionNM_020759c.13588_13589insTTTAp.L4530fs--Ruzzo2019 G
STARD9     iHART3167chr15:
42984934-42984934
CTexonicMaternalstopgainNM_020759c.C11158Tp.Q3720X52.05.739E-5Ruzzo2019 G
UBR1     iHART2253chr15:
43252854-43252854
GGTexonicMaternalframeshift insertionNM_174916c.4745dupAp.N1582fs--Ruzzo2019 G
UBR1     iHART2255chr15:
43252854-43252854
GGTexonicMaternalframeshift insertionNM_174916c.4745dupAp.N1582fs--Ruzzo2019 G
TGM7     iHART3249chr15:
43579747-43579749
TCATexonicPaternalframeshift deletionNM_052955c.677_678delp.V226fs--Ruzzo2019 G
CCNDBP1     iHART3041chr15:
43477706-43477706
GGCexonicPaternalframeshift insertionNM_012142c.11dupCp.A4fs--Ruzzo2019 G
CDAN1     iHART2410chr15:
43019838-43019843
TGGGAGTexonicMaternalframeshift deletionNM_138477c.3072_3076delp.P1024fs--Ruzzo2019 G
CDAN1     iHART2409chr15:
43019838-43019843
TGGGAGTexonicMaternalframeshift deletionNM_138477c.3072_3076delp.P1024fs--Ruzzo2019 G
TTBK2     iHART2748chr15:
43069317-43069317
GAexonicPaternalstopgainNM_173500c.C1321Tp.R441X38.08.294E-6Ruzzo2019 G
CDAN1     iHART2412chr15:
43019838-43019843
TGGGAGTexonicMaternalframeshift deletionNM_138477c.3072_3076delp.P1024fs