or
or
Exact

Results for "Guo2018"

Variant Events: 1721

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
UNC80     M19547chr2:
210707072-210707072
ATsplicingPaternalsplicing17.1-Guo2018 T
ADNP     M27882chr20:
49510619-49510619
ATexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.T632A
c.T632A
c.T632A
c.T632A
p.L211X
p.L211X
p.L211X
p.L211X
39.0-Guo2018 T
NCOR1     M15225chr17:
15983379-15983379
CGsplicingUnknownsplicing10.338.245E-5Guo2018 T
RIMS1     M19735chr6:
72892155-72892155
CGexonicMaternalstopgainNM_014989c.C981Gp.Y327X14.71-Guo2018 T
RIMS1     M23785chr6:
72967953-72967953
CTexonicMaternalnonsynonymous SNVNM_001168407
NM_001168408
NM_001168409
NM_001168410
NM_014989
c.C1315T
c.C1318T
c.C1075T
c.C1273T
c.C2896T
p.R439C
p.R440C
p.R359C
p.R425C
p.R966C
23.78.412E-6Guo2018 T
UNC80     M16067chr2:
210737525-210737525
CAexonicMaternalnonsynonymous SNVNM_032504
NM_182587
c.C3677A
c.C3662A
p.A1226D
p.A1221D
35.0-Guo2018 T
UNC80     M18393chr2:
210782618-210782618
CGexonicPaternalnonsynonymous SNVNM_032504
NM_182587
c.C4949G
c.C4934G
p.T1650R
p.T1645R
33.0-Guo2018 T
SCN2A     M17441chr2:
166179813-166179813
CTexonicUnknownstopgainNM_001040143
NM_001040142
NM_021007
c.C1819T
c.C1819T
c.C1819T
p.R607X
p.R607X
p.R607X
39.08.245E-6Guo2018 T
SHANK1     M23139chr19:
51190000-51190000
CTsplicingDe novosplicing20.4-Guo2018 T
ASH1L     M15039chr1:
155316175-155316175
CGexonicPaternalnonsynonymous SNVNM_018489c.G7889Cp.R2630T36.0-Guo2018 T
MED13L     M13354chr12:
116403973-116403973
CAexonicPaternalnonsynonymous SNVNM_015335c.G6301Tp.V2101L35.08.238E-6Guo2018 T
TSC2     M17674chr16:
2100431-2100431
CTexonicPaternalnonsynonymous SNVNM_000548
NM_001077183
NM_001114382
c.C169T
c.C169T
c.C169T
p.R57C
p.R57C
p.R57C
18.39-Guo2018 T
CHD2     M18930chr15:
93543766-93543766
CTexonicPaternalnonsynonymous SNVNM_001271c.C4033Tp.R1345W25.3-Guo2018 T
SCN2A     M19672chr2:
166170189-166170189
CTexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C1094T
c.C1094T
c.C1094T
p.T365M
p.T365M
p.T365M
26.7-Guo2018 T
ASH1L     M19813chr1:
155448636-155448636
CTexonicPaternalnonsynonymous SNVNM_018489c.G4025Ap.R1342Q26.43.303E-5Guo2018 T
WAC     M23067chr10:
28906698-28906698
CGexonicPaternalnonsynonymous SNVNM_100486
NM_016628
NM_100264
c.C1550G
c.C1859G
c.C1724G
p.T517S
p.T620S
p.T575S
33.0-Guo2018 T
FOXP1     M23720chr3:
71247418-71247418
CTexonicMaternalnonsynonymous SNVNM_001244814
NM_001244812
NM_001244816
NM_001012505
NM_001244808
NM_001244810
NM_032682
c.G115A
c.G115A
c.G115A
c.G115A
c.G115A
c.G115A
c.G115A
p.G39R
p.G39R
p.G39R
p.G39R
p.G39R
p.G39R
p.G39R
31.01.653E-5Guo2018 T
CUL3     M03563chr2:
225370672-225370672
CAsplicingDe novosplicing23.5-Guo2018 T
NCKAP1     M23209chr2:
183792844-183792844
CTsplicingDe novosplicing24.2-Guo2018 T
RIMS1     M01493chr6:
72975162-72975162
CAexonicUnknownstopgainNM_014989c.C3264Ap.C1088X37.0-Guo2018 T
ZNF292     M02463chr6:
87965835-87965835
GGATCACexonicDe novoframeshift insertionNM_015021c.2488_2489insATCACp.D830fs--Guo2018 T
NAV2     M23133chr11:
20136247-20136247
GAexonicPaternalnonsynonymous SNVNM_001111019
NM_001111018
NM_145117
NM_182964
NM_001244963
c.G4262A
c.G6878A
c.G7070A
c.G7079A
c.G7247A
p.R1421Q
p.R2293Q
p.R2357Q
p.R2360Q
p.R2416Q
35.04.166E-5Guo2018 T
EPHB2     M15021chr1:
23238971-23238971
GAexonicPaternalnonsynonymous SNVNM_001309192
NM_001309193
NM_004442
NM_017449
c.G2557A
c.G2731A
c.G2734A
c.G2731A
p.D853N
p.D911N
p.D912N
p.D911N
34.0-Guo2018 T
RIMS1     M12510chr6:
73023281-73023281
GTexonicMaternalnonsynonymous SNVNM_001168407
NM_014989
c.G1996T
c.G4036T
p.D666Y
p.D1346Y
25.7-Guo2018 T
SCN2A     M01813chr2:
166179814-166179816
GAAGexonicDe novoframeshift deletionNM_001040143
NM_001040142
NM_021007
c.1821_1822del
c.1821_1822del
c.1821_1822del
p.R607fs
p.R607fs
p.R607fs
--Guo2018 T
SYNGAP1     M02073chr6:
33405522-33405522
CGexonicDe novostopgainNM_006772c.C840Gp.Y280X34.0-Guo2018 T
CDKL5     M01813chrX:
18668586-18668586
CTexonicDe novostopgainNM_003159
NM_001037343
c.C2854T
c.C2854T
p.R952X
p.R952X
38.01.0E-4Guo2018 T
MECP2     M03323chrX:
153296516-153296516
GAexonicDe novostopgainNM_001110792
NM_004992
NM_001316337
c.C799T
c.C763T
c.C484T
p.R267X
p.R255X
p.R162X
33.0-Guo2018 T
CHD8     M02193chr14:
21871185-21871186
ATAexonicDe novoframeshift deletionNM_001170629
NM_020920
c.3704delA
c.2867delA
p.N1235fs
p.N956fs
--Guo2018 T
CHD8     M08656chr14:
21878123-21878124
ATAexonicDe novoframeshift deletionNM_001170629
NM_020920
c.2250delA
c.1413delA
p.K750fs
p.K471fs
--Guo2018 T
MECP2     M04493chrX:
153296399-153296399
GAexonicUnknownstopgainNM_001110792
NM_004992
NM_001316337
c.C916T
c.C880T
c.C601T
p.R306X
p.R294X
p.R201X
32.0-Guo2018 T
SCN2A     M11451chr2:
166201068-166201068
CTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.C2566T
c.C2566T
c.C2566T
p.R856X
p.R856X
p.R856X
41.0-Guo2018 T
SCN2A     M08856chr2:
166229733-166229733
ACsplicingDe novosplicing25.5-Guo2018 T
STXBP1     M12428chr9:
130428475-130428477
ATCAexonicDe novoframeshift deletionNM_001032221
NM_003165
c.695_696del
c.695_696del
p.I232fs
p.I232fs
--Guo2018 T
DYRK1A     M12327chr21:
38877659-38877659
GAexonicDe novononsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.G1313A
c.G1286A
c.G1313A
c.G1313A
p.R438H
p.R429H
p.R438H
p.R438H
27.5-Guo2018 T
SCN2A     M15222chr2:
166229841-166229841
GCexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G3956C
c.G3956C
c.G3956C
p.R1319P
p.R1319P
p.R1319P
32.0-Guo2018 T
SCN2A     M12434chr2:
166152561-166152561
GGCexonicDe novoframeshift insertionNM_001040143
NM_001040142
NM_021007
c.229dupC
c.229dupC
c.229dupC
p.V76fs
p.V76fs
p.V76fs
--Guo2018 T
SCN2A     M21522chr2:
166246026-166246028
CAACexonicDe novoframeshift deletionNM_001040143
NM_001040142
NM_021007
c.5711_5712del
c.5711_5712del
c.5711_5712del
p.Q1904fs
p.Q1904fs
p.Q1904fs
--Guo2018 T
CHD8     M16139chr14:
21882530-21882530
TCexonicDe novononsynonymous SNVNM_001170629
NM_020920
c.A2072G
c.A1235G
p.D691G
p.D412G
24.2-Guo2018 T
SCN2A     M21701chr2:
166167003-166167003
AGexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.A868G
c.A868G
c.A868G
p.I290V
p.I290V
p.I290V
5.129-Guo2018 T
POGZ     M21552chr1:
151379747-151379747
CTexonicDe novononsynonymous SNVNM_145796
NM_207171
NM_001194938
NM_001194937
NM_015100
c.G2111A
c.G2237A
c.G2210A
c.G2369A
c.G2396A
p.S704N
p.S746N
p.S737N
p.S790N
p.S799N
32.0-Guo2018 T
SCN2A     M23243chr2:
166243497-166243499
ATTAexonicDe novoframeshift deletionNM_001040143
NM_001040142
NM_021007
c.4794_4795del
c.4794_4795del
c.4794_4795del
p.D1598fs
p.D1598fs
p.D1598fs
--Guo2018 T
SCN2A     M23149chr2:
166245634-166245634
CTexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C5318T
c.C5318T
c.C5318T
p.A1773V
p.A1773V
p.A1773V
18.44-Guo2018 T
MAP3K1     M19767chr5:
56176602-56176602
GAexonicPaternalnonsynonymous SNVNM_005921c.G2152Ap.A718T35.0-Guo2018 T
UNC80     M20766chr2:
210858118-210858118
GAexonicMaternalnonsynonymous SNVNM_182587
NM_032504
c.G9206A
c.G9278A
p.R3069H
p.R3093H
34.0-Guo2018 T
ANK3     M19816chr10:
61846521-61846521
GAexonicPaternalnonsynonymous SNVNM_001149
NM_020987
NM_001204403
NM_001204404
c.C1064T
c.C3662T
c.C3644T
c.C3665T
p.P355L
p.P1221L
p.P1215L
p.P1222L
34.0-Guo2018 T
WDFY3     M20641chr4:
85781627-85781627
GAexonicDe novononsynonymous SNVNM_014991c.C118Tp.R40W23.4-Guo2018 T
PTEN     M21723chr10:
89717650-89717650
TGexonicUnknownstopgainNM_000314
NM_001304718
NM_001304717
c.T675G
c.T84G
c.T1194G
p.Y225X
p.Y28X
p.Y398X
48.0-Guo2018 T
GPRIN1     M02523chr5:
176026557-176026557
GTexonicUnknownstopgainNM_052899c.C279Ap.C93X21.12.647E-5Guo2018 T
APOBR     M08814chr16:
28507100-28507101
AGAexonicPaternalframeshift deletionNM_018690c.739delGp.G247fs--Guo2018 T
TCF4     M21404chr18:
52921925-52921925
GAexonicUnknownstopgainNM_001243234
NM_001243235
NM_001243236
NM_001243232
NM_001243233
NM_001306208
NM_001243231
NM_001243227
NM_001243230
NM_001306207
NM_001083962
NM_001243228
NM_003199
NM_001243226
c.C673T
c.C673T
c.C673T
c.C940T
c.C763T
c.C940T
c.C1027T
c.C1081T
c.C1144T
c.C1081T
c.C1153T
c.C1171T
c.C1153T
c.C1459T
p.R225X
p.R225X
p.R225X
p.R314X
p.R255X
p.R314X
p.R343X
p.R361X
p.R382X
p.R361X
p.R385X
p.R391X
p.R385X
p.R487X
37.0-Guo2018 T
CHD3     M03573chr17:
7814871-7814871
CTexonicUnknownstopgainNM_005852
NM_001005271
NM_001005273
c.C5869T
c.C6148T
c.C5971T
p.R1957X
p.R2050X
p.R1991X
44.0-Guo2018 T
CRYBG3     M26445chr3:
97634457-97634459
GCTGexonicMaternalframeshift deletionNM_153605c.8119_8120delp.L2707fs--Guo2018 T
SCN2A     M08704chr2:
166153563-166153563
CTexonicUnknownstopgainNM_001040143
NM_001040142
NM_021007
c.C304T
c.C304T
c.C304T
p.R102X
p.R102X
p.R102X
39.0-Guo2018 T
MKI67     M02532chr10:
129905111-129905113
CTGCexonicUnknownframeshift deletionNM_001145966
NM_002417
c.3911_3912del
c.4991_4992del
p.T1304fs
p.T1664fs
-0.0219Guo2018 T
ASXL3     GX0149.p1chr18:
31323981-31323983
CTGCexonicDe novoframeshift deletionNM_030632c.4170_4171delp.T1390fs--Guo2018 T
ANK2     M32110chr4:
114251508-114251508
CTexonicDe novostopgainNM_001148
NM_020977
NM_001127493
c.C3007T
c.C3007T
c.C2980T
p.R1003X
p.R1003X
p.R994X
39.0-Guo2018 T
AK8     M17485chr9:
135602922-135602922
CAsplicingUnknownsplicing7.168-Guo2018 T
LZTR1     M02433chr22:
21348884-21348884
CAexonicPaternalstopgainNM_006767c.C1653Ap.Y551X41.0-Guo2018 T
MKI67     M12471chr10:
129905111-129905113
CTGCexonicUnknownframeshift deletionNM_001145966
NM_002417
c.3911_3912del
c.4991_4992del
p.T1304fs
p.T1664fs
-0.0219Guo2018 T
MKI67     M01713chr10:
129905111-129905113
CTGCexonicUnknownframeshift deletionNM_001145966
NM_002417
c.3911_3912del
c.4991_4992del
p.T1304fs
p.T1664fs
-0.0219Guo2018 T
DDX3X     HN0072.p1chrX:
41196659-41196659
AGsplicingDe novosplicing18.98-Guo2018 T
CTTNBP2     M32001chr7:
117385943-117385947
TCTCATexonicDe novoframeshift deletionNM_033427c.3473_3476delp.V1158fs--Guo2018 T
FOXP1     HN0004.p1chr3:
71027085-71027086
CACexonicDe novoframeshift deletionNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.941delT
c.1013delT
c.1247delT
c.1241delT
c.1241delT
c.1241delT
c.1241delT
c.1241delT
p.L314fs
p.L338fs
p.L416fs
p.L414fs
p.L414fs
p.L414fs
p.L414fs
p.L414fs
--Guo2018 T
DYRK1A     HN0026.p1chr21:
38862503-38862503
CTexonicDe novostopgainNM_001396
NM_130436
NM_130438
NM_101395
c.C691T
c.C664T
c.C691T
c.C691T
p.R231X
p.R222X
p.R231X
p.R231X
50.0-Guo2018 T
ASXL3     GX0083.p1chr18:
31325279-31325279
CTexonicDe novostopgainNM_030632c.C5467Tp.R1823X44.0-Guo2018 T
ASXL3     GX0384.p1chr18:
31319462-31319463
ACAexonicDe novoframeshift deletionNM_030632c.2095delCp.P699fs--Guo2018 T
CHD8     GX0493.p1chr14:
21899169-21899169
GAexonicDe novostopgainNM_001170629c.C634Tp.R212X36.0-Guo2018 T
CDKL5     GX0251.p1chrX:
18627650-18627650
CGexonicDe novostopgainNM_003159
NM_001037343
c.C2112G
c.C2112G
p.Y704X
p.Y704X
41.0-Guo2018 T
SCN2A     HN0130.p1chr2:
166170536-166170538
CCACexonicDe novoframeshift deletionNM_001040143
NM_001040142
NM_021007
c.1302_1303del
c.1302_1303del
c.1302_1303del
p.A434fs
p.A434fs
p.A434fs
--Guo2018 T
SCN2A     GX0205.p1chr2:
166170175-166170176
CACexonicDe novoframeshift deletionNM_001040143
NM_001040142
NM_021007
c.1081delA
c.1081delA
c.1081delA
p.N361fs
p.N361fs
p.N361fs
--Guo2018 T
SHANK2     HN0112.p1chr11:
70507786-70507786
GCexonicDe novostopgainNM_133266c.C87Gp.Y29X37.0-Guo2018 T
SCN2A     GX0234.p1chr2:
166234155-166234155
CTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.C4303T
c.C4303T
c.C4303T
p.R1435X
p.R1435X
p.R1435X
40.0-Guo2018 T
MED13L     HN0070.p1chr12:
116429039-116429039
CCAexonicDe novoframeshift insertionNM_015335c.3719dupTp.L1240fs--Guo2018 T
MECP2     M31872chrX:
153296516-153296516
GAexonicDe novostopgainNM_001110792
NM_004992
NM_001316337
c.C799T
c.C763T
c.C484T
p.R267X
p.R255X
p.R162X
33.0-Guo2018 T
RALGAPB     GX0341.p1chr20:
37154561-37154561
TTAexonicDe novoframeshift insertionNM_001282917
NM_001282918
NM_020336
c.1927dupA
c.1927dupA
c.1927dupA
p.S642fs
p.S642fs
p.S642fs
--Guo2018 T
NAA15     M30862chr4:
140282877-140282877
GAsplicingDe novosplicing24.4-Guo2018 T
AHNAK     GX0189.p1chr11:
62286312-62286312
GAexonicMaternalstopgainNM_001620c.C15577Tp.Q5193X56.0-Guo2018 T
AHNAK     GX0442.p1chr11:
62284793-62284795
TCGTexonicMaternalframeshift deletionNM_001620c.17094_17095delp.G5698fs-8.277E-6Guo2018 T
ARHGAP32     M32041chr11:
128839261-128839261
TTAexonicMaternalframeshift insertionNM_014715
NM_001142685
c.4757dupT
c.5804dupT
p.L1586fs
p.L1935fs
--Guo2018 T
ALDH5A1     GX0406.p1chr6:
24528223-24528223
ACsplicingMaternalsplicing14.06-Guo2018 T
TNRC6B     GX0159.p1chr22:
40662113-40662113
CTexonicDe novostopgainNM_001162501
NM_015088
c.C1879T
c.C1879T
p.Q627X
p.Q627X
39.0-Guo2018 T
TNRC6B     M30985chr22:
40711475-40711476
AGAexonicDe novoframeshift deletionNM_015088
NM_001162501
NM_001024843
c.4538delG
c.4868delG
c.2456delG
p.R1513fs
p.R1623fs
p.R819fs
--Guo2018 T
CTTNBP2     M31980chr7:
117417690-117417692
CAACexonicDe novoframeshift deletionNM_033427c.2651_2652delp.F884fs--Guo2018 T
ZNF292     M32023chr6:
87967763-87967763
AATexonicDe novoframeshift insertionNM_015021c.4417dupTp.R1472fs--Guo2018 T
DSCAM     M31817chr21:
41385260-41385260
CTsplicing;exonicMaternalnonsynonymous SNVNM_001389c.G5740Ap.G1914S13.27-Guo2018 T
DNAJC6     M30973chr1:
65858549-65858549
GAsplicingMaternalsplicing13.46-Guo2018 T
IQGAP3     GX0023.p1chr1:
156508601-156508602
CTCexonicMaternalframeshift deletionNM_178229c.3280delAp.S1094fs--Guo2018 T
FOXP1     M30624chr3:
71027165-71027165
TTTGATACCAGATTCAACTGCAAGGAAAAAAACAACGTCTTAexonicMaternalstopgainNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.861_862insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
c.933_934insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
c.1167_1168insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
c.1161_1162insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
c.1161_1162insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
c.1161_1162insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
c.1161_1162insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
c.1161_1162insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
p.S288_V289delinsX
p.S312_V313delinsX
p.S390_V391delinsX
p.S388_V389delinsX
p.S388_V389delinsX
p.S388_V389delinsX
p.S388_V389delinsX
p.S388_V389delinsX
--Guo2018 T
CTTNBP2     HN0016.p1chr7:
117417690-117417692
CAACexonicMaternalframeshift deletionNM_033427c.2651_2652delp.F884fs--Guo2018 T
CHD8     GX0347.p1chr14:
21862151-21862151
TAexonicMaternalstopgainNM_001170629
NM_020920
c.A5803T
c.A4966T
p.R1935X
p.R1656X
46.0-Guo2018 T
CUL7     GX0434.p1chr6:
43012533-43012533
CTexonicMaternalstopgainNM_001168370
NM_014780
c.G3381A
c.G3129A
p.W1127X
p.W1043X
42.08.249E-6Guo2018 T
CUL7     M31878chr6:
43006661-43006661
CTexonicMaternalstopgainNM_001168370
NM_014780
c.G4611A
c.G4359A
p.W1537X
p.W1453X
42.0-Guo2018 T
RELN     GX0320.p1chr7:
103393662-103393662
CAsplicingMaternalsplicing13.81-Guo2018 T
PASK     GX0306.p1chr2:
242047581-242047581
CAsplicingMaternalsplicing12.55-Guo2018 T
UNC80     GX0185.p1chr2:
210858989-210858989
GAsplicingUnknownsplicing17.31-Guo2018 T
SYNCRIP     GX0108.p1chr6:
86324491-86324492
CACexonicUnknownframeshift deletionNM_001159675
NM_006372
c.1749delT
c.1854delT
p.F583fs
p.F618fs
--Guo2018 T
KMT5B     GX0295.p1chr11:
67934646-67934646
CTsplicingMaternalsplicing21.5-Guo2018 T
KMT2C     GX0527.p1chr7:
151878033-151878033
CCTexonicMaternalframeshift insertionNM_170606c.6911_6912insAp.M2304fs--Guo2018 T
LZTR1     GX0502.p1chr22:
21341862-21341862
GGTexonicMaternalframeshift insertionNM_006767c.391dupTp.M130fs--Guo2018 T
LZTR1     GX0382.p1chr22:
21350286-21350287
GAGexonicMaternalframeshift deletionNM_006767c.2105delAp.E702fs--Guo2018 T
CTTNBP2     GX0131.p1chr7:
117420557-117420557
CAexonicPaternalstopgainNM_033427c.G2461Tp.G821X38.0-Guo2018 T
CTTNBP2     GX0225.p1chr7:
117351768-117351769
ACAexonicPaternalframeshift deletionNM_033427c.4814delGp.G1605fs--Guo2018 T
CUL7     M31830chr6:
43006061-43006061
GAexonicPaternalstopgainNM_001168370
NM_014780
c.C4969T
c.C4717T
p.R1657X
p.R1573X
45.08.27E-6Guo2018 T
CTTNBP2     GX0233.p1chr7:
117420573-117420573
GCexonicPaternalstopgainNM_033427c.C2445Gp.Y815X36.0-Guo2018 T
ANK3     HN0112.p1chr10:
61900109-61900109
CTsplicingPaternalsplicing19.568.244E-6Guo2018 T
WDFY3     GX0355.p1chr4:
85609337-85609337
GAexonicUnknownstopgainNM_014991c.C9445Tp.R3149X53.0-Guo2018 T
CTTNBP2     GX0187.p1chr7:
117361174-117361175
ATAexonicPaternalframeshift deletionNM_033427c.4457delAp.N1486fs--Guo2018 T
CRYBG3     GX0299.p1chr3:
97593884-97593885
AGAexonicPaternalframeshift deletionNM_153605c.3847delGp.V1283fs--Guo2018 T
PASK     GX0507.p1chr2:
242063452-242063452
GCexonicPaternalstopgainNM_001252119
NM_001252122
NM_001252124
NM_015148
NM_001252120
c.C2816G
c.C2711G
c.C2816G
c.C2816G
c.C2816G
p.S939X
p.S904X
p.S939X
p.S939X
p.S939X
46.01.667E-5Guo2018 T
PASK     GX0076.p1chr2:
242065860-242065870
CTGTTGGATCACexonicPaternalframeshift deletionNM_001252119
NM_001252122
NM_001252124
NM_015148
NM_001252120
c.2460_2469del
c.2355_2364del
c.2460_2469del
c.2460_2469del
c.2460_2469del
p.H820fs
p.H785fs
p.H820fs
p.H820fs
p.H820fs
--Guo2018 T
SPP2     M30880chr2:
234959661-234959663
CAGCexonicPaternalframeshift deletionNM_006944c.133_134delp.S45fs-8.25E-6Guo2018 T
RELN     M30612chr7:
103243834-103243835
GCGexonicPaternalframeshift deletionNM_005045
NM_173054
c.3249delG
c.3249delG
p.W1083fs
p.W1083fs
--Guo2018 T
GPRIN1     GX0290.p1chr5:
176026557-176026557
GTexonicPaternalstopgainNM_052899c.C279Ap.C93X21.12.647E-5Guo2018 T
DLG2     GX0350.p1chr11:
85337630-85337630
CAsplicingPaternalsplicing--Guo2018 T
MFRP     HN0031.p1chr11:
119216279-119216279
GGAexonicPaternalframeshift insertionNM_031433c.491_492insTp.Y164fs-3.314E-5Guo2018 T
KMT5B     GX0447.p1chr11:
67926606-67926606
TTTTTTACGCexonicPaternalstopgainNM_001300908
NM_017635
NM_001300907
c.486_487insGCGTAAAA
c.1206_1207insGCGTAAAA
c.690_691insGCGTAAAA
p.K163_N164delinsAX
p.K403_N404delinsAX
p.K231_N232delinsAX
--Guo2018 T
FOXP1     JS0070.p1chr3:
71027086-71027086
AAGexonicDe novoframeshift insertionNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.940dupC
c.1012dupC
c.1246dupC
c.1240dupC
c.1240dupC
c.1240dupC
c.1240dupC
c.1240dupC
p.L314fs
p.L338fs
p.L416fs
p.L414fs
p.L414fs
p.L414fs
p.L414fs
p.L414fs
--Guo2018 T
DYRK1A     HEN0102.p1chr21:
38878525-38878526
AGAexonicDe novoframeshift deletionNM_001396
NM_130436
NM_101395
c.1671delG
c.1644delG
c.1671delG
p.Q557fs
p.Q548fs
p.Q557fs
--Guo2018 T
SCN2A     HEN0329.p1chr2:
166201068-166201068
CTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.C2566T
c.C2566T
c.C2566T
p.R856X
p.R856X
p.R856X
41.0-Guo2018 T
MECP2     JS0024.p1chrX:
153296777-153296777
GAexonicDe novostopgainNM_001110792
NM_004992
NM_001316337
c.C538T
c.C502T
c.C223T
p.R180X
p.R168X
p.R75X
32.0-Guo2018 T
TCF7L2     M32029chr10:
114925726-114925726
GTexonicPaternalstopgainNM_001146285
NM_001198526
NM_001146274
NM_030756
c.G1735T
c.G1735T
c.G1804T
c.G1786T
p.E579X
p.E579X
p.E602X
p.E596X
42.0-Guo2018 T
TCF4     HN0002.p1chr18:
53302936-53302936
CAexonicPaternalstopgainNM_001243226c.G193Tp.E65X12.82-Guo2018 T
CHD8     HEN0083.p1chr14:
21868156-21868157
CTCexonicDe novoframeshift deletionNM_001170629
NM_020920
c.4800delA
c.3963delA
p.L1600fs
p.L1321fs
--Guo2018 T
CHD2     HEN0362.p1chr15:
93518107-93518107
AGsplicingDe novosplicing24.0-Guo2018 T
CHD8     HN0277.p1chr14:
21861921-21861921
CCAexonicMaternalframeshift insertionNM_001170629
NM_020920
c.6032_6033insT
c.5195_5196insT
p.E2011fs
p.E1732fs
--Guo2018 T
CACNA2D3     SD0023.p1chr3:
54850898-54850898
GAsplicingMaternalsplicing21.9-Guo2018 T
CTTNBP2     SX0012.p1chr7:
117368250-117368250
AACexonicMaternalframeshift insertionNM_033427c.3947dupGp.R1316fs-4.123E-5Guo2018 T
CTTNBP2     M32940chr7:
117417690-117417692
CAACexonicMaternalframeshift deletionNM_033427c.2651_2652delp.F884fs--Guo2018 T
WAC     HN0181.p1chr10:
28824670-28824674
TAGAGTexonicDe novoframeshift deletionNM_016628
NM_100264
NM_100486
c.259_262del
c.124_127del
c.259_262del
p.R87fs
p.R42fs
p.R87fs
--Guo2018 T
SCN2A     GX0569.p1chr2:
166165305-166165305
GAsplicingDe novosplicing17.27-Guo2018 T
AHNAK     SD0030.p1chr11:
62293809-62293809
TTAexonicMaternalstopgainNM_001620c.8079dupTp.K2694_F2695delinsX--Guo2018 T
WAC     GX0532.p1chr10:
28824677-28824678
AGAexonicDe novoframeshift deletionNM_016628
NM_100264
NM_100486
c.266delG
c.131delG
c.266delG
p.R89fs
p.R44fs
p.R89fs
--Guo2018 T
ADNP     SD0087.p1chr20:
49509095-49509096
TATexonicUnknownframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2155delT
c.2155delT
c.2155delT
c.2155delT
p.Y719fs
p.Y719fs
p.Y719fs
p.Y719fs
--Guo2018 T
UIMC1     M32487chr5:
176409546-176409547
GTGexonicMaternalframeshift deletionNM_001199298
NM_016290
NM_001199297
c.70delA
c.70delA
c.70delA
p.T24fs
p.T24fs
p.T24fs
--Guo2018 T
NFIA     SD0062.p1chr1:
61554055-61554055
CTexonicUnknownstopgainNM_001134673
NM_001145511
NM_005595
NM_001145512
c.C262T
c.C238T
c.C262T
c.C397T
p.R88X
p.R80X
p.R88X
p.R133X
42.0-Guo2018 T
MECP2     HEN0356.p1chrX:
153296777-153296777
GAexonicUnknownstopgainNM_001110792
NM_004992
NM_001316337
c.C538T
c.C502T
c.C223T
p.R180X
p.R168X
p.R75X
32.0-Guo2018 T
FOXP1     GX0547.p1chr3:
71179794-71179798
TGCGGTexonicMaternalframeshift deletionNM_001244815c.37_40delp.P13fs--Guo2018 T
CTTNBP2     HEN0307.p1chr7:
117368250-117368250
AACexonicMaternalframeshift insertionNM_033427c.3947dupGp.R1316fs-4.123E-5Guo2018 T
PASK     SD0079.p1chr2:
242063549-242063549
CAsplicingMaternalsplicing9.391.77E-5Guo2018 T
MECP2     JS0008.p1chrX:
153296568-153296569
ACAexonicMaternalframeshift deletionNM_001110792
NM_004992
NM_001316337
c.746delG
c.710delG
c.431delG
p.G249fs
p.G237fs
p.G144fs
--Guo2018 T
PASK     HEN0076.p1chr2:
242066299-242066300
GAGexonicPaternalframeshift deletionNM_001252119
NM_001252122
NM_001252124
NM_015148
NM_001252120
c.2030delT
c.1925delT
c.2030delT
c.2030delT
c.2030delT
p.V677fs
p.V642fs
p.V677fs
p.V677fs
p.V677fs
--Guo2018 T
CHD8     GX0540.p1chr14:
21876546-21876547
GTGexonicPaternalframeshift deletionNM_001170629
NM_020920
c.2654delA
c.1817delA
p.N885fs
p.N606fs
--Guo2018 T
TCF4     SD0100.p1chr18:
53255760-53255760
GGTexonicPaternalframeshift insertionNM_001243230c.6dupAp.R3fs--Guo2018 T
SPAST     HEN0249.p1chr2:
32362255-32362259
CAGGTCexonicPaternalframeshift deletionNM_199436
NM_014946
c.1396_1397del
c.1492_1493del
p.R466fs
p.R498fs
--Guo2018 T
SCN2A     SX0026.p1chr2:
166165305-166165305
GAsplicingUnknownsplicing17.27-Guo2018 T
SCN2A     HEN0166.p1chr2:
166243281-166243282
ATAexonicUnknownframeshift deletionNM_001040143
NM_001040142
NM_021007
c.4578delT
c.4578delT
c.4578delT
p.D1526fs
p.D1526fs
p.D1526fs
--Guo2018 T
AHNAK     SD0030.p1chr11:
62284793-62284795
TCGTexonicPaternalframeshift deletionNM_001620c.17094_17095delp.G5698fs-8.277E-6Guo2018 T
UIMC1     M32834chr5:
176395929-176395936
TAGTTCACTexonicUnknownframeshift deletionNM_001199298
NM_016290
NM_001199297
c.820_826del
c.820_826del
c.820_826del
p.V274fs
p.V274fs
p.V274fs
--Guo2018 T
P4HA2     M26855chr5:
131531157-131531157
GCexonicMaternalnonsynonymous SNVNM_001017973
NM_001017974
NM_004199
NM_001142598
NM_001142599
c.C1382G
c.C1382G
c.C1388G
c.C1382G
c.C1388G
p.A461G
p.A461G
p.A463G
p.A461G
p.A463G
32.01.652E-5Guo2018 T
TRIO     M26778chr5:
14482770-14482770
GAexonicMaternalnonsynonymous SNVNM_007118c.G6545Ap.R2182H32.05.779E-5Guo2018 T
CUL7     M20582chr6:
43020447-43020447
CTexonicMaternalnonsynonymous SNVNM_001168370
NM_014780
c.G236A
c.G80A
p.R79H
p.R27H
32.0-Guo2018 T
CUL7     M04063chr6:
43019495-43019495
CTexonicMaternalnonsynonymous SNVNM_001168370
NM_014780
c.G839A
c.G587A
p.R280Q
p.R196Q
31.05.766E-5Guo2018 T
PASK     JS0037.p1chr2:
242066215-242066215
GTexonicUnknownstopgainNM_001252119
NM_001252122
NM_001252124
NM_015148
NM_001252120
c.C2115A
c.C2010A
c.C2115A
c.C2115A
c.C2115A
p.C705X
p.C670X
p.C705X
p.C705X
p.C705X
41.0-Guo2018 T
PASK     JS0041.p1chr2:
242066538-242066538
TTGexonicUnknownframeshift insertionNM_001252119
NM_001252122
NM_001252124
NM_015148
NM_001252120
c.1791dupC
c.1686dupC
c.1791dupC
c.1791dupC
c.1791dupC
p.K598fs
p.K563fs
p.K598fs
p.K598fs
p.K598fs
--Guo2018 T
ANK2     M26960chr4:
114294285-114294285
GAexonicMaternalnonsynonymous SNVNM_020977
NM_001148
NM_001127493
c.G5395A
c.G11650A
c.G5368A
p.E1799K
p.E3884K
p.E1790K
32.08.24E-6Guo2018 T
NRXN1     M02013chr2:
50733692-50733692
CTexonicMaternalnonsynonymous SNVNM_004801
NM_001135659
c.G2438A
c.G2558A
p.R813H
p.R853H
30.04.247E-5Guo2018 T
ARVCF     M23104chr22:
19966546-19966546
CTexonicMaternalnonsynonymous SNVNM_001670c.G1454Ap.G485D30.0-Guo2018 T
NBEA     M32095chr13:
35730285-35730285
CTexonicMaternalnonsynonymous SNVNM_015678c.C2593Tp.R865C30.0-Guo2018 T
LZTR1     M03523chr22:
21350271-21350271
CTexonicUnknownnonsynonymous SNVNM_006767c.C2089Tp.R697W34.02.482E-5Guo2018 T
CTNND2     M21665chr5:
11159760-11159760
GAexonicUnknownnonsynonymous SNVNM_001288716
NM_001288715
NM_001288717
NM_001332
c.C1076T
c.C1814T
c.C788T
c.C2087T
p.S359L
p.S605L
p.S263L
p.S696L
34.0-Guo2018 T
CSMD1     M19783chr8:
3165343-3165343
GAexonicMaternalnonsynonymous SNVNM_033225c.C3824Tp.A1275V34.01.0E-4Guo2018 T
RIMS1     M15248chr6:
73023290-73023290
GTexonicMaternalnonsynonymous SNVNM_001168407
NM_014989
c.G2005T
c.G4045T
p.A669S
p.A1349S
32.0-Guo2018 T
KIRREL3     M16257chr11:
126310360-126310360
GAexonicMaternalnonsynonymous SNVNM_001161707
NM_001301097
NM_032531
c.C1337T
c.C1337T
c.C1337T
p.P446L
p.P446L
p.P446L
36.03.458E-5Guo2018 T
DOCK8     M26940chr9:
396857-396857
CTexonicMaternalnonsynonymous SNVNM_001190458
NM_001193536
NM_203447
c.C2743T
c.C2839T
c.C3043T
p.R915C
p.R947C
p.R1015C
33.04.119E-5Guo2018 T
SCN2A     M30859chr2:
166201312-166201312
GAexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G2810A
c.G2810A
c.G2810A
p.R937H
p.R937H
p.R937H
33.0-Guo2018 T
SCN2A     M30337chr2:
166168598-166168598
GAexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G1034A
c.G1034A
c.G1034A
p.G345D
p.G345D
p.G345D
34.0-Guo2018 T
NSD2     GX0086.p1chr4:
1978364-1978364
GTexonicDe novononsynonymous SNVNM_001042424
NM_133335
NM_133331
NM_133330
c.G3784T
c.G3784T
c.G3784T
c.G3784T
p.A1262S
p.A1262S
p.A1262S
p.A1262S
34.0-Guo2018 T
CUL3     GX0263.p1chr2:
225346695-225346695
GAexonicDe novononsynonymous SNVNM_001257197
NM_001257198
NM_003590
c.C1745T
c.C1961T
c.C1943T
p.P582L
p.P654L
p.P648L
33.0-Guo2018 T
CACNA2D3     M16226chr3:
54930847-54930847
CTexonicPaternalnonsynonymous SNVNM_018398c.C2318Tp.A773V34.0-Guo2018 T
ANK2     M08113chr4:
114251470-114251470
GAexonicUnknownnonsynonymous SNVNM_001148
NM_020977
NM_001127493
c.G2969A
c.G2969A
c.G2942A
p.R990Q
p.R990Q
p.R981Q
36.02.481E-5Guo2018 T
DYRK1A     M32128chr21:
38878489-38878489
CTexonicPaternalnonsynonymous SNVNM_001396
NM_130436
NM_101395
c.C1634T
c.C1607T
c.C1634T
p.A545V
p.A536V
p.A545V
34.08.32E-6Guo2018 T
KIRREL3     M19544chr11:
126310415-126310415
GTexonicPaternalnonsynonymous SNVNM_001161707
NM_001301097
NM_032531
c.C1282A
c.C1282A
c.C1282A
p.Q428K
p.Q428K
p.Q428K
33.06.043E-5Guo2018 T
SCN1A     M30377chr2:
166850674-166850674
CTexonicMaternalnonsynonymous SNVNM_001165963
NM_001165964
NM_006920
NM_001202435
c.G4834A
c.G4750A
c.G4801A
c.G4834A
p.V1612I
p.V1584I
p.V1601I
p.V1612I
33.02.0E-4Guo2018 T
IQGAP3     GX0510.p1chr1:
156513966-156513966
CTexonicMaternalnonsynonymous SNVNM_178229c.G2438Ap.R813H34.08.237E-6Guo2018 T
UNC80     GX0029.p1chr2:
210699694-210699694
CTexonicMaternalnonsynonymous SNVNM_032504
NM_182587
c.C3001T
c.C2986T
p.R1001C
p.R996C
32.0-Guo2018 T
UNC80     GX0521.p1chr2:
210681738-210681738
GAexonicMaternalnonsynonymous SNVNM_032504
NM_182587
c.G1441A
c.G1441A
p.D481N
p.D481N
35.0-Guo2018 T
HIVEP3     HN0012.p1chr1:
41979410-41979410
CTexonicMaternalnonsynonymous SNVNM_001127714
NM_024503
c.G5482A
c.G5482A
p.D1828N
p.D1828N
33.03.674E-5Guo2018 T
NBEA     HN0105.p1chr13:
35624411-35624411
GAexonicBoth parentsnonsynonymous SNVNM_015678c.G851Ap.R284H34.08.837E-6Guo2018 T
ASH1L     GX0392.p1chr1:
155311845-155311845
CTexonicMaternalnonsynonymous SNVNM_018489c.G8342Ap.R2781Q36.0-Guo2018 T
TAF13     M32286chr1:
109608851-109608851
CTexonicMaternalnonsynonymous SNVNM_005645c.G110Ap.R37Q37.04.949E-5Guo2018 T
ANK2     GX0007.p1chr4:
114294285-114294285
GAexonicMaternalnonsynonymous SNVNM_020977
NM_001148
NM_001127493
c.G5395A
c.G11650A
c.G5368A
p.E1799K
p.E3884K
p.E1790K
32.08.24E-6Guo2018 T
ANK2     GX0440.p1chr4:
114177003-114177003
CGexonicMaternalnonsynonymous SNVNM_001148
NM_020977
NM_001127493
c.C1103G
c.C1103G
c.C1040G
p.A368G
p.A368G
p.A347G
33.0-Guo2018 T
ALDH5A1     GX0506.p1chr6:
24505125-24505125
GAexonicMaternalnonsynonymous SNVNM_001080
NM_170740
c.G638A
c.G638A
p.R213Q
p.R213Q
37.08.24E-6Guo2018 T
CTNND2     M30910chr5:
11159760-11159760
GAexonicMaternalnonsynonymous SNVNM_001288716
NM_001288715
NM_001288717
NM_001332
c.C1076T
c.C1814T
c.C788T
c.C2087T
p.S359L
p.S605L
p.S263L
p.S696L
34.0-Guo2018 T
POGZ     M19813chr1:
151402109-151402109
GAexonicDe novostopgainNM_207171
NM_001194938
NM_001194937
NM_015100
c.C379T
c.C379T
c.C538T
c.C538T
p.Q127X
p.Q127X
p.Q180X
p.Q180X
37.0-Guo2018 T
CACNA2D3     M30832chr3:
55038848-55038848
GAexonicMaternalnonsynonymous SNVNM_018398c.G2749Ap.A917T32.08.286E-6Guo2018 T
DSCAM     M17551chr21:
41446967-41446967
GAexonicDe novostopgainNM_001271534
NM_001389
c.C4885T
c.C4885T
p.R1629X
p.R1629X
41.0-Guo2018 T
UNC80     M30343chr2:
210858135-210858135
AGexonicMaternalnonsynonymous SNVNM_182587
NM_032504
c.A9223G
c.A9295G
p.K3075E
p.K3099E
31.04.594E-5Guo2018 T
FOXP1     GX0338.p1chr3:
71247423-71247423
GCexonicMaternalnonsynonymous SNVNM_001244814
NM_001244812
NM_001244816
NM_001012505
NM_001244808
NM_001244810
NM_032682
c.C110G
c.C110G
c.C110G
c.C110G
c.C110G
c.C110G
c.C110G
p.S37C
p.S37C
p.S37C
p.S37C
p.S37C
p.S37C
p.S37C
35.0-Guo2018 T
GRIN2B     M20277chr12:
13768147-13768147
GAexonicDe novostopgainNM_000834c.C1555Tp.R519X40.08.24E-6Guo2018 T
DYRK1A     M20274chr21:
38853069-38853069
GTexonicDe novostopgainNM_001396
NM_130436
NM_130438
NM_101395
c.G457T
c.G430T
c.G457T
c.G457T
p.E153X
p.E144X
p.E153X
p.E153X
49.0-Guo2018 T
FOXP1     M31817chr3:
71247378-71247378
GAexonicMaternalnonsynonymous SNVNM_001244814
NM_001244812
NM_001244816
NM_001012505
NM_001244808
NM_001244810
NM_032682
c.C155T
c.C155T
c.C155T
c.C155T
c.C155T
c.C155T
c.C155T
p.A52V
p.A52V
p.A52V
p.A52V
p.A52V
p.A52V
p.A52V
33.02.486E-5Guo2018 T
GIGYF1     GX0213.p1chr7:
100284044-100284044
CTexonicMaternalnonsynonymous SNVNM_022574c.G707Ap.R236H30.03.533E-5Guo2018 T
SETD5     M21987chr3:
9487425-9487425
GAsplicingPaternalsplicing17.71-Guo2018 T
TRRAP     GX0040.p1chr7:
98606063-98606063
CGexonicMaternalnonsynonymous SNVNM_003496
NM_001244580
c.C10688G
c.C10775G
p.S3563C
p.S3592C
32.0-Guo2018 T
GIGYF2     M23762chr2:
233655745-233655745
GTexonicDe novostopgainNM_001103148
NM_001103146
NM_001103147
NM_015575
c.G940T
c.G958T
c.G1024T
c.G958T
p.E314X
p.E320X
p.E342X
p.E320X
34.0-Guo2018 T
CHD8     M12452chr14:
21854308-21854308
GAexonicPaternalnonsynonymous SNVNM_001170629
NM_020920
c.C7210T
c.C6373T
p.R2404W
p.R2125W
17.68-Guo2018 T
CSMD1     M30337chr8:
3267076-3267076
CTexonicMaternalnonsynonymous SNVNM_033225c.G1613Ap.R538Q36.03.456E-5Guo2018 T
RELN     M30330chr7:
103230169-103230169
GAexonicMaternalnonsynonymous SNVNM_005045
NM_173054
c.C4019T
c.C4019T
p.P1340L
p.P1340L
32.01.649E-5Guo2018 T
RIMS1     M30928chr6:
72962473-72962473
GAexonicMaternalnonsynonymous SNVNM_001168407
NM_001168408
NM_001168409
NM_001168410
NM_014989
c.G1130A
c.G1130A
c.G887A
c.G1085A
c.G2708A
p.R377Q
p.R377Q
p.R296Q
p.R362Q
p.R903Q
32.0-Guo2018 T
CUL7     GX0313.p1chr6:
43006087-43006087
CTexonicMaternalnonsynonymous SNVNM_001168370
NM_014780
c.G4943A
c.G4691A
p.R1648Q
p.R1564Q
34.0-Guo2018 T
ARID1B     M30880chr6:
157502187-157502187
GAexonicMaternalnonsynonymous SNVNM_017519
NM_020732
c.G3181A
c.G3220A
p.D1061N
p.D1074N
36.08.249E-6Guo2018 T
ARID1B     GX0170.p1chr6:
157405814-157405814
GAexonicMaternalnonsynonymous SNVNM_017519
NM_020732
c.G2017A
c.G2056A
p.D673N
p.D686N
31.0-Guo2018 T
NAV2     GX0078.p1chr11:
19970353-19970353
GAexonicMaternalnonsynonymous SNVNM_001111018
NM_145117
NM_182964
NM_001244963
c.G2180A
c.G2372A
c.G2372A
c.G2441A
p.R727Q
p.R791Q
p.R791Q
p.R814Q
36.01.651E-5Guo2018 T
ASH1L     M17685chr1:
155448115-155448115
GAexonicPaternalnonsynonymous SNVNM_018489c.C4546Tp.R1516C19.09-Guo2018 T
PAX5     GX0365.p1chr9:
37015019-37015019
CTexonicMaternalnonsynonymous SNVNM_001280551
NM_001280556
NM_001280547
NM_001280548
NM_001280549
NM_001280550
NM_001280552
NM_001280553
NM_001280554
NM_016734
c.G61A
c.G61A
c.G385A
c.G385A
c.G385A
c.G385A
c.G385A
c.G385A
c.G385A
c.G385A
p.V21M
p.V21M
p.V129M
p.V129M
p.V129M
p.V129M
p.V129M
p.V129M
p.V129M
p.V129M
30.08.244E-6Guo2018 T
COL4A3BP     M17640chr5:
74721309-74721309
GAexonicPaternalnonsynonymous SNVNM_005713
NM_031361
NM_001130105
c.C472T
c.C472T
c.C856T
p.R158C
p.R158C
p.R286C
34.0-Guo2018 T
DLG2     M30940chr11:
83173084-83173084
CTexonicMaternalnonsynonymous SNVNM_001142702
NM_001142700
NM_001206769
NM_001300983
NM_001364
NM_001142699
c.G859A
c.G2104A
c.G2584A
c.G2413A
c.G2467A
c.G2782A
p.A287T
p.A702T
p.A862T
p.A805T
p.A823T
p.A928T
34.08.288E-6Guo2018 T
SHANK2     M32289chr11:
70829927-70829927
CTexonicMaternalunknown33.04.741E-5Guo2018 T
DOCK8     M30585chr9:
396846-396846
GAexonicMaternalnonsynonymous SNVNM_001190458
NM_001193536
NM_203447
c.G2732A
c.G2828A
c.G3032A
p.R911H
p.R943H
p.R1011H
36.08.237E-6Guo2018 T
DOCK8     M31875chr9:
396837-396837
GAexonicMaternalnonsynonymous SNVNM_001190458
NM_001193536
NM_203447
c.G2723A
c.G2819A
c.G3023A
p.R908Q
p.R940Q
p.R1008Q
37.08.0E-4Guo2018 T
DOCK8     GX0500.p1chr9:
404990-404990
CAexonicMaternalnonsynonymous SNVNM_001190458
NM_001193536
NM_203447
c.C3007A
c.C3103A
c.C3307A
p.H1003N
p.H1035N
p.H1103N
34.0-Guo2018 T
ASH1L     M23185chr1:
155349842-155349842
GCexonicPaternalnonsynonymous SNVNM_018489c.C6169Gp.H2057D27.1-Guo2018 T
DOCK8     GX0042.p1chr9:
404990-404990
CAexonicMaternalnonsynonymous SNVNM_001190458
NM_001193536
NM_203447
c.C3007A
c.C3103A
c.C3307A
p.H1003N
p.H1035N
p.H1103N
34.0-Guo2018 T
POGZ     M23639chr1:
151379390-151379390
GAexonicMaternalnonsynonymous SNVNM_145796
NM_207171
NM_001194938
NM_001194937
NM_015100
c.C2257T
c.C2383T
c.C2356T
c.C2515T
c.C2542T
p.R753W
p.R795W
p.R786W
p.R839W
p.R848W
25.98.265E-6Guo2018 T
HECTD1     M32292chr14:
31642985-31642985
CTexonicMaternalnonsynonymous SNVNM_015382c.G631Ap.A211T35.03.966E-5Guo2018 T
HECTD1     GX0242.p1chr14:
31609141-31609141
GAexonicMaternalnonsynonymous SNVNM_015382c.C2936Tp.P979L35.08.286E-6Guo2018 T
CCDC88C     M31992chr14:
91805671-91805671
CTexonicMaternalnonsynonymous SNVNM_001080414c.G760Ap.V254I31.02.585E-5Guo2018 T
CCDC88C     GX0441.p1chr14:
91770115-91770115
TCexonicMaternalnonsynonymous SNVNM_001080414c.A3565Gp.I1189V31.0-Guo2018 T
AGAP2     GX0112.p1chr12:
58127944-58127944
CTexonicMaternalnonsynonymous SNVNM_001122772
NM_014770
c.G1414A
c.G406A
p.A472T
p.A136T
32.08.375E-6Guo2018 T
DLG2     M30856chr11:
83182725-83182725
CTexonicMaternalnonsynonymous SNVNM_001142702
NM_001142700
NM_001206769
NM_001300983
NM_001364
NM_001142699
c.G467A
c.G1712A
c.G2192A
c.G2021A
c.G2075A
c.G2390A
p.R156Q
p.R571Q
p.R731Q
p.R674Q
p.R692Q
p.R797Q
34.04.183E-5Guo2018 T
NBEA     GX0291.p1chr13:
35622758-35622758
CTexonicMaternalnonsynonymous SNVNM_015678c.C782Tp.T261I32.0-Guo2018 T
AGAP2