or
or
Exact

Results for "Leblond2019"

Variant Events: 6768

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
VIL1     PN400103chr2:
219294332-219294332
CTexonicDe novosynonymous SNVNM_007127c.C783Tp.S261S-3.0E-4Leblond2019 E
KIF17     PN400532chr1:
21031146-21031146
GAexonicDe novononsynonymous SNVNM_001122819
NM_001287212
NM_020816
c.C917T
c.C617T
c.C917T
p.T306M
p.T206M
p.T306M
26.91.649E-5Leblond2019 E
ANKMY1     PN400149chr2:
241463346-241463346
GAexonicDe novosynonymous SNVNM_001282780
NM_001308375
NM_017844
NM_001282781
NM_016552
NM_001282771
c.C1098T
c.C1335T
c.C1098T
c.C804T
c.C1521T
c.C1788T
p.S366S
p.S445S
p.S366S
p.S268S
p.S507S
p.S596S
-8.304E-6Leblond2019 E
PLCD4     PN400579chr2:
219501200-219501200
GAexonicDe novononsynonymous SNVNM_032726c.G2189Ap.R730H33.08.281E-6Leblond2019 E
DUSP12     PN400133chr1:
161722953-161722953
TCexonicDe novononsynonymous SNVNM_007240c.T763Cp.S255P2.7318.238E-6Leblond2019 E
PHTF1     PN400539chr1:
114246774-114246774
GAexonicDe novononsynonymous SNVNM_006608c.C1819Tp.R607C17.04-Leblond2019 E
C1orf186     PN400149chr1:
206243181-206243181
GAexonicDe novosynonymous SNVNM_001007544c.C81Tp.T27T-1.649E-5Leblond2019 E
PLA2G4A     PN400102chr1:
186925350-186925350
CTexonicDe novononsynonymous SNVNM_001311193
NM_024420
c.C1273T
c.C1453T
p.R425C
p.R485C
19.22-Leblond2019 E
SH3RF1     PN400512chr4:
170028218-170028218
CTexonicDe novononsynonymous SNVNM_020870c.G2278Ap.E760K17.278.413E-6Leblond2019 E
COL8A1     PN400560chr3:
99514072-99514072
CTexonicDe novononsynonymous SNVNM_020351
NM_001850
c.C1327T
c.C1327T
p.L443F
p.L443F
12.86-Leblond2019 E
SLCO6A1     PN400542chr5:
101735368-101735368
CTexonicDe novononsynonymous SNVNM_001308014
NM_001289004
NM_001289002
NM_173488
c.G946A
c.G1519A
c.G1705A
c.G1705A
p.G316R
p.G507R
p.G569R
p.G569R
11.364.954E-5Leblond2019 E
GC     PN400137chr4:
72629627-72629627
TGexonicDe novononsynonymous SNVNM_000583
NM_001204306
NM_001204307
c.A500C
c.A500C
c.A557C
p.Y167S
p.Y167S
p.Y186S
19.95-Leblond2019 E
TOPBP1     PN400128chr3:
133336016-133336016
GAexonicDe novosynonymous SNVNM_007027c.C3747Tp.H1249H--Leblond2019 E
KALRN     PN400117chr3:
124377314-124377314
AGexonicDe novononsynonymous SNVNM_007064
NM_001024660
c.A979G
c.A6070G
p.N327D
p.N2024D
24.0-Leblond2019 E
ACOX2     PN400157chr3:
58517419-58517419
CAsplicingDe novosplicing9.54-Leblond2019 E
DCAF1     PN400538chr3:
51475802-51475802
GCexonicDe novononsynonymous SNVNM_001171904
NM_014703
c.C622G
c.C625G
p.L208V
p.L209V
14.18-Leblond2019 E
CEP72     PN400115chr5:
635530-635530
TCexonicDe novosynonymous SNVNM_018140c.T735Cp.C245C12.03-Leblond2019 E
FCHSD1     PN400117chr5:
141021291-141021291
AGexonicDe novononsynonymous SNVNM_033449c.T1985Cp.M662T0.398-Leblond2019 E
TAAR1     PN400590chr6:
132966464-132966464
CTexonicDe novononsynonymous SNVNM_138327c.G679Ap.A227T0.01-Leblond2019 E
SEMA5A     PN400590chr5:
9202106-9202106
GAexonicDe novononsynonymous SNVNM_003966c.C893Tp.P298L33.0-Leblond2019 E
DAP     PN400157chr5:
10683641-10683641
CTexonicDe novosynonymous SNVNM_004394c.G195Ap.R65R--Leblond2019 E
CCT5     PN400528chr5:
10263313-10263313
TGexonicDe novononsynonymous SNVNM_001306154
NM_001306155
NM_001306153
NM_001306156
NM_012073
c.T1220G
c.T1106G
c.T1322G
c.T1271G
c.T1385G
p.L407R
p.L369R
p.L441R
p.L424R
p.L462R
25.1-Leblond2019 E
HDAC3     PN400149chr5:
141001080-141001080
AGexonicDe novosynonymous SNVNM_003883c.T1242Cp.Y414Y-8.237E-6Leblond2019 E
PCDHB3     PN400543chr5:
140480895-140480895
CTexonicDe novononsynonymous SNVNM_018937c.C662Tp.P221L5.2395.798E-5Leblond2019 E
STYXL1     PN400149chr7:
75657971-75657971
GAexonicUnknown, Mosaic Inh.stopgainNM_016086c.C154Tp.R52X30.01.678E-5Leblond2019 E
Leblond2019 E
STYXL1     PN400150chr7:
75657971-75657971
GAexonicUnknown, Mosaic Inh.stopgainNM_016086c.C154Tp.R52X30.01.678E-5Leblond2019 E
Leblond2019 E
ANKIB1     PN400576chr7:
91948778-91948778
CTexonicDe novosynonymous SNVNM_019004c.C621Tp.P207P-2.489E-5Leblond2019 E
ANKIB1     PN400215chr7:
91924406-91924406
AGexonicDe novosynonymous SNVNM_019004c.A114Gp.T38T--Leblond2019 E
PHF14     PN400203chr7:
11078433-11078433
GAexonicDe novononsynonymous SNVNM_014660c.G2027Ap.R676Q17.53.14E-5Leblond2019 E
MED20     PN400565chr6:
41884544-41884544
CTexonicDe novononsynonymous SNVNM_001305457
NM_004275
c.G148A
c.G148A
p.A50T
p.A50T
8.897.0E-4Leblond2019 E
AMPH     PN400584chr7:
38431556-38431556
GAexonicDe novosynonymous SNVNM_139316
NM_001635
c.C1545T
c.C1671T
p.N515N
p.N557N
1.0468.242E-6Leblond2019 E
MRM2     PN400166chr7:
2275023-2275023
CTexonicDe novononsynonymous SNVNM_013393c.G475Ap.A159T35.0-Leblond2019 E
C11orf87     PN400540chr11:
109294695-109294695
CTexonicDe novosynonymous SNVNM_207645c.C336Tp.G112G-8.307E-6Leblond2019 E
ZBTB5     PN400195chr9:
37442167-37442167
GCexonicDe novononsynonymous SNVNM_014872c.C382Gp.P128A16.318.256E-6Leblond2019 E
SPTBN2     PN400515chr11:
66457517-66457517
GAexonicUnknown, De novononsynonymous SNVNM_006946c.C5803Tp.R1935C19.862.476E-5Leblond2019 E
Leblond2019 E
PDE3B     PN400171chr11:
14891190-14891190
CAexonicDe novononsynonymous SNVNM_000922c.C3323Ap.A1108E8.122-Leblond2019 E
LETM2     PN400190chr8:
38264917-38264917
CTexonicDe novononsynonymous SNVNM_144652
NM_001199659
NM_001199660
NM_001286787
NM_001286819
c.C1064T
c.C1208T
c.C740T
c.C740T
c.C1349T
p.S355L
p.S403L
p.S247L
p.S247L
p.S450L
7.838-Leblond2019 E
CDCA2     PN400587chr8:
25323820-25323820
GAexonicDe novononsynonymous SNVNM_152562c.G517Ap.E173K13.15-Leblond2019 E
FBXW5     PN400129chr9:
139836842-139836842
GAexonicDe novononsynonymous SNVNM_018998c.C752Tp.T251M11.394.567E-5Leblond2019 E
FBXW5     PN400129chr9:
139836001-139836001
GAexonicDe novononsynonymous SNVNM_018998c.C1232Tp.S411L24.21.839E-5Leblond2019 E
C2CD4B     PN400137chr15:
62456206-62456206
TCexonicDe novosynonymous SNVNM_001007595c.A978Gp.E326E--Leblond2019 E
UBL3     PN400579chr13:
30341772-30341772
GAexonicDe novononsynonymous SNVNM_007106c.C284Tp.P95L29.8-Leblond2019 E
ZNF592     PN400241chr15:
85327103-85327103
TGexonicDe novononsynonymous SNVNM_014630c.T1197Gp.D399E13.758.244E-6Leblond2019 E
C2CD4B     PN400137chr15:
62456227-62456227
AGexonicDe novosynonymous SNVNM_001007595c.T957Cp.F319F-1.831E-5Leblond2019 E
CCDC60     PN400564chr12:
119942952-119942952
CTexonicDe novononsynonymous SNVNM_178499c.C727Tp.R243W13.188.285E-6Leblond2019 E
TSKU     PN400195chr11:
76507362-76507362
GAexonicDe novosynonymous SNVNM_001258210
NM_015516
c.G702A
c.G702A
p.L234L
p.L234L
--Leblond2019 E
ANKS1B     PN400171chr12:
99640092-99640092
ATexonicDe novononsynonymous SNVNM_152788c.T2307Ap.N769K12.38-Leblond2019 E
LRRC10     PN400515chr12:
70003851-70003851
CGexonicDe novosynonymous SNVNM_201550c.G768Cp.A256A--Leblond2019 E
NLGN2     PN400584chr17:
7319124-7319124
CTexonicDe novosynonymous SNVNM_020795c.C1332Tp.G444G-6.0E-4Leblond2019 E
ADAMTS18     PN400230chr16:
77328886-77328886
GCexonicDe novosynonymous SNVNM_199355c.C2940Gp.P980P--Leblond2019 E
CIDEA     PN400575chr18:
12262928-12262928
GAexonicDe novononsynonymous SNVNM_001279c.G143Ap.R48H22.55.786E-5Leblond2019 E
B3GNTL1     PN400546chr17:
81006427-81006427
AGexonicDe novononsynonymous SNVNM_001009905c.T197Cp.I66T16.642.471E-5Leblond2019 E
GPR139     PN400527chr16:
20043060-20043060
CTexonicDe novosynonymous SNVNM_001002911c.G1059Ap.P353P-6.67E-5Leblond2019 E
ANPEP     PN400171chr15:
90347216-90347216
CGexonicDe novosynonymous SNVNM_001150c.G1197Cp.V399V--Leblond2019 E
DDX19A       PN400551chr16:
70395343-70395343
GAexonicDe novononsynonymous SNVNM_018332c.G316Ap.V106I12.96-Leblond2019 E
MMP25     PN400137chr16:
3109017-3109017
TCexonicDe novononsynonymous SNVNM_022468c.T1607Cp.L536P12.47-Leblond2019 E
MYH14     PN400543chr19:
50752378-50752378
GAexonicDe novosynonymous SNVNM_024729
NM_001077186
NM_001145809
c.G1440A
c.G1464A
c.G1464A
p.A480A
p.A488A
p.A488A
-4.675E-5Leblond2019 E
BCKDHA     PN400219chr19:
41928902-41928902
GAsplicingDe novosplicing18.64-Leblond2019 E
MORC3     PN400128chr21:
37732302-37732302
CTexonicUnknown, De novononsynonymous SNVNM_015358c.C1258Tp.R420W20.4-Leblond2019 E
Leblond2019 E
RIMS4     PN400137chr20:
43384973-43384973
GTexonicUnknown, De novostopgainNM_001205317
NM_182970
c.C615A
c.C612A
p.Y205X
p.Y204X
19.6-Leblond2019 E
Leblond2019 E
MEX3D     PN400170chr19:
1567604-1567604
GAexonicDe novononsynonymous SNVNM_001174118
NM_203304
c.C454T
c.C454T
p.P152S
p.P152S
15.431.0E-4Leblond2019 E
CCBE1     PN400117chr18:
57363910-57363910
TCexonicDe novononsynonymous SNVNM_133459c.A163Gp.T55A17.84-Leblond2019 E
LRP3     PN400149chr19:
33696920-33696920
CTexonicDe novononsynonymous SNVNM_002333c.C1244Tp.A415V14.13-Leblond2019 E
BTBD2     PN400118chr19:
1986885-1986885
TCexonicDe novononsynonymous SNVNM_017797c.A1360Gp.K454E7.431-Leblond2019 E
C1orf50     PN400100chr1:
43240508-43240508
GAexonicUnknownnonsynonymous SNVNM_024097c.G383Ap.G128D34.0-Leblond2019 E
MACF1     PN400100chr1:
39903464-39903464
GAexonicUnknownnonsynonymous SNVNM_012090c.G11827Ap.E3943K35.05.0E-4Leblond2019 E
IGSF3     PN400100chr1:
117131400-117131400
CAexonicUnknownstopgainNM_001007237
NM_001542
c.G2356T
c.G2416T
p.E786X
p.E806X
40.0-Leblond2019 E
LRRC41     PN400100chr1:
46768880-46768880
CAexonicUnknownnonsynonymous SNVNM_006369c.G115Tp.G39C27.42.0E-4Leblond2019 E
FBLN1     PN400582chr22:
45946442-45946442
CAexonicDe novosynonymous SNVNM_001996
NM_006485
NM_006486
NM_006487
c.C1644A
c.C1644A
c.C1644A
c.C1644A
p.G548G
p.G548G
p.G548G
p.G548G
--Leblond2019 E
TRIOBP     PN400157chr22:
38153881-38153881
CTexonicDe novosynonymous SNVNM_007032
NM_138632
NM_001039141
c.C810T
c.C810T
c.C5949T
p.S270S
p.S270S
p.S1983S
8.469-Leblond2019 E
GRIPAP1     PN400137chrX:
48849920-48849920
AGexonicDe novononsynonymous SNVNM_020137c.T377Cp.V126A0.008-Leblond2019 E
MECP2     PN400532chrX:
153297764-153297764
GAexonicUnknown, De novononsynonymous SNVNM_001110792
NM_004992
c.C307T
c.C271T
p.R103W
p.R91W
23.21.143E-5Leblond2019 E
Leblond2019 E
PCDHA12     PN400100chr5:
140257422-140257422
GTexonicUnknownstopgainNM_018903
NM_031864
c.G2365T
c.G2365T
p.E789X
p.E789X
38.0-Leblond2019 E
NNT     PN400100chr5:
43613185-43613185
AAGexonicUnknownframeshift insertionNM_012343
NM_182977
c.328dupG
c.328dupG
p.A109fs
p.A109fs
-7.265E-5Leblond2019 E
HLA-DRB1     PN400100chr6:
32549398-32549399
ACAexonicUnknownframeshift deletionNM_002124c.587delGp.S196fs-0.0066Leblond2019 E
FAM8A1     PN400100chr6:
17601123-17601154
CGCGGCGCCGCCGCCCCCGCAGCTGGGCTATTCexonicUnknownframeshift deletionNM_016255c.484_514delp.A162fs--Leblond2019 E
IGSF3     PN400100chr1:
117146504-117146504
GAexonicUnknownnonsynonymous SNVNM_001007237
NM_001542
c.C1366T
c.C1426T
p.R456C
p.R476C
26.28.361E-6Leblond2019 E
IGSF3     PN400100chr1:
117142868-117142868
CTexonicUnknownstopgainNM_001007237
NM_001542
c.G1724A
c.G1784A
p.W575X
p.W595X
35.0-Leblond2019 E
IGSF3     PN400100chr1:
117156585-117156585
GAexonicUnknownstopgainNM_001542
NM_001007237
c.C634T
c.C634T
p.Q212X
p.Q212X
37.08.27E-6Leblond2019 E
IGSF3     PN400100chr1:
117156459-117156459
CTexonicUnknownnonsynonymous SNVNM_001542
NM_001007237
c.G760A
c.G760A
p.D254N
p.D254N
31.0-Leblond2019 E
CTBP2     PN400100chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
PRSS3     PN400100chr9:
33794797-33794799
TGATexonicUnknownframeshift deletionNM_001197097c.9_10delp.M3fs-0.0398Leblond2019 E
HMBS     PN400100chr11:
118958995-118958995
CTexonicUnknownnonsynonymous SNVNM_000190
NM_001024382
NM_001258208
NM_001258209
c.C64T
c.C13T
c.C64T
c.C13T
p.R22C
p.R5C
p.R22C
p.R5C
33.01.647E-5Leblond2019 E
CTBP2     PN400100chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
HLA-DRB1     PN400100chr6:
32549584-32549584
CCTexonicUnknownframeshift insertionNM_002124c.401dupAp.K134fs-0.0561Leblond2019 E
HLA-DRB1     PN400100chr6:
32549579-32549580
TGTexonicUnknownframeshift deletionNM_002124c.406delCp.Q136fs-0.0555Leblond2019 E
WDR60     PN400100chr7:
158695184-158695184
AATexonicUnknownframeshift insertionNM_018051c.1256dupTp.I419fs--Leblond2019 E
MUC12     PN400100chr7:
100616185-100616185
CTintronicUnknown9.446-Leblond2019 E
PABPC3     PN400100chr13:
25671210-25671210
CTexonicUnknownstopgainNM_030979c.C874Tp.Q292X35.05.0E-4Leblond2019 E
PABPC3     PN400100chr13:
25671097-25671097
AATexonicUnknownframeshift insertionNM_030979c.761_762insTp.K254fs-0.1057Leblond2019 E
TYRO3     PN400100chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
PABPC3     PN400100chr13:
25671272-25671273
AGAexonicUnknownframeshift deletionNM_030979c.937delGp.A313fs--Leblond2019 E
GXYLT1     PN400100chr12:
42499711-42499711
CAexonicUnknownnonsynonymous SNVNM_001099650
NM_173601
c.G680T
c.G773T
p.R227L
p.R258L
28.9-Leblond2019 E
GXYLT1     PN400100chr12:
42499692-42499692
ATexonicUnknownstopgainNM_001099650
NM_173601
c.T699A
c.T792A
p.Y233X
p.Y264X
33.0-Leblond2019 E
GXYLT1     PN400100 Complex Event; expand row to view variants  Unknownframeshift insertion, nonframeshift deletionNM_001099650
NM_173601
NM_001099650
NM_173601
c.573_574insAA
c.666_667insAA
c.575_577del
c.668_670del
p.L192fs
p.L223fs
p.192_193del
p.223_224del
--Leblond2019 E
Leblond2019 E
GXYLT1     PN400100chr12:
42499739-42499739
CTexonicUnknownnonsynonymous SNVNM_001099650
NM_173601
c.G652A
c.G745A
p.E218K
p.E249K
36.0-Leblond2019 E
UNC13A     PN400100chr19:
17737533-17737533
CTexonicUnknownnonsynonymous SNVNM_001080421c.G3982Ap.G1328S23.9-Leblond2019 E
ABCA7     PN400100chr19:
1047507-1047514
AGGAGCAGAexonicUnknownframeshift deletionNM_019112c.2124_2130delp.E708fs-0.0024Leblond2019 E
NIT1     PN400102chr1:
161089651-161089653
TAGTexonicUnknownframeshift deletionNM_001185093
NM_001185092
NM_001185094
NM_005600
c.456_457del
c.501_502del
c.393_394del
c.501_502del
p.V152fs
p.V167fs
p.V131fs
p.V167fs
--Leblond2019 E
MEGF8     PN400100chr19:
42855822-42855822
CTexonicUnknownnonsynonymous SNVNM_001410
NM_001271938
c.C2809T
c.C3010T
p.R937W
p.R1004W
18.568.0E-4Leblond2019 E
HYDIN     PN400100chr16:
70977799-70977799
AATGTGGGGTexonicUnknownframeshift insertionNM_001270974c.6584_6585insACCCCACAp.S2195fs--Leblond2019 E
MEGF11     PN400100chr15:
66206090-66206090
CTexonicUnknownnonsynonymous SNVNM_032445c.G2695Ap.D899N25.50.001Leblond2019 E
LAMA1     PN400100chr18:
7049171-7049171
CTexonicUnknownnonsynonymous SNVNM_005559c.G674Ap.R225H33.00.0064Leblond2019 E
GAS8     PN400100chr16:
90097861-90097861
GAexonicUnknownnonsynonymous SNVNM_001286209
NM_001481
c.G170A
c.G245A
p.R57Q
p.R82Q
29.50.0032Leblond2019 E
MUC12     PN400102chr7:
100616336-100616336
GAintronicUnknown11.98-Leblond2019 E
GRIK2     PN400102chr6:
102513772-102513772
TGexonicUnknownstopgainNM_001166247c.T2663Gp.L888X43.0-Leblond2019 E
CTBP2     PN400102chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
LZTS2     PN400102chr10:
102765299-102765299
CTexonicUnknownnonsynonymous SNVNM_032429c.C1153Tp.R385W25.01.0E-4Leblond2019 E
CACNA2D3     PN400102chr3:
54925426-54925426
CTexonicUnknownnonsynonymous SNVNM_018398c.C2195Tp.T732M25.80.0076Leblond2019 E
GORASP1     PN400102chr3:
39140352-39140352
CAexonicUnknownnonsynonymous SNVNM_001278790
NM_001278789
NM_031899
c.G484T
c.G664T
c.G949T
p.D162Y
p.D222Y
p.D317Y
19.940.0086Leblond2019 E
ALDH5A1     PN400102chr6:
24495246-24495246
CTexonicUnknownnonsynonymous SNVNM_001080
NM_170740
c.C22T
c.C22T
p.R8W
p.R8W
19.932.0E-4Leblond2019 E
BCL6     PN400102chr3:
187451364-187451364
GAexonicUnknownnonsynonymous SNVNM_001134738
NM_001130845
NM_001706
c.C118T
c.C118T
c.C118T
p.R40C
p.R40C
p.R40C
21.11.0E-4Leblond2019 E
GXYLT1     PN400102 Complex Event; expand row to view variants  Unknownframeshift insertion, nonframeshift deletionNM_001099650
NM_173601
NM_001099650
NM_173601
c.575_577del
c.668_670del
c.573_574insAA
c.666_667insAA
p.192_193del
p.223_224del
p.L192fs
p.L223fs
--Leblond2019 E
Leblond2019 E
GXYLT1     PN400102chr12:
42499739-42499739
CTexonicUnknownnonsynonymous SNVNM_001099650
NM_173601
c.G652A
c.G745A
p.E218K
p.E249K
36.0-Leblond2019 E
PABPC3     PN400102chr13:
25671272-25671273
AGAexonicUnknownframeshift deletionNM_030979c.937delGp.A313fs--Leblond2019 E
PABPC3     PN400102chr13:
25671097-25671097
AATexonicUnknownframeshift insertionNM_030979c.761_762insTp.K254fs-0.1057Leblond2019 E
ARHGEF17     PN400102chr11:
73076741-73076741
GAexonicUnknownnonsynonymous SNVNM_014786c.G5744Ap.R1915Q35.00.0017Leblond2019 E
CTBP2     PN400102chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
GXYLT1     PN400102chr12:
42499711-42499711
CAexonicUnknownnonsynonymous SNVNM_001099650
NM_173601
c.G680T
c.G773T
p.R227L
p.R258L
28.9-Leblond2019 E
GXYLT1     PN400102chr12:
42499692-42499692
ATexonicUnknownstopgainNM_001099650
NM_173601
c.T699A
c.T792A
p.Y233X
p.Y264X
33.0-Leblond2019 E
CNN2     PN400102chr19:
1037781-1037781
CAexonicUnknownnonsynonymous SNVNM_201277
NM_001303499
NM_001303501
NM_004368
c.C695A
c.C779A
c.C875A
c.C812A
p.P232H
p.P260H
p.P292H
p.P271H
22.68.565E-5Leblond2019 E
CNN2     PN400102chr19:
1037756-1037756
GAexonicUnknownnonsynonymous SNVNM_201277
NM_001303499
NM_001303501
NM_004368
c.G670A
c.G754A
c.G850A
c.G787A
p.G224S
p.G252S
p.G284S
p.G263S
28.73.0E-4Leblond2019 E
TTC3     PN400102chr21:
38529482-38529482
GAintronicUnknown14.170.0081Leblond2019 E
CAPN12     PN400102chr19:
39230735-39230735
GAexonicUnknownnonsynonymous SNVNM_144691c.C685Tp.R229C18.410.0012Leblond2019 E
ABCA3     PN400102chr16:
2367764-2367764
TAexonicUnknownnonsynonymous SNVNM_001089c.A875Tp.E292V25.00.0022Leblond2019 E
HERC2     PN400102chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HYDIN     PN400102chr16:
70977799-70977799
AATGTGGGGTexonicUnknownframeshift insertionNM_001270974c.6584_6585insACCCCACAp.S2195fs--Leblond2019 E
HYDIN     PN400102chr16:
70902541-70902541
GAexonicUnknownnonsynonymous SNVNM_001270974c.C11242Tp.R3748C18.08.328E-6Leblond2019 E
RPL14     PN400103chr3:
40499001-40499018
GGCCCTTCCCGGACTCGCGintronicUnknown-0.0032Leblond2019 E
PAQR6     PN400103chr1:
156215934-156215936
CCACexonicUnknownframeshift deletionNM_001272104
NM_001272108
NM_198406
NM_001272105
c.157_158del
c.157_158del
c.157_158del
c.148_149del
p.W53fs
p.W53fs
p.W53fs
p.W50fs
-5.031E-5Leblond2019 E
MUC12     PN400103chr7:
100616185-100616185
CTintronicUnknown9.446-Leblond2019 E
SDHA     PN400103chr5:
256483-256485
CTTCexonicUnknownframeshift deletionNM_001294332
NM_004168
c.1800_1801del
c.1944_1945del
p.T600fs
p.T648fs
-0.0135Leblond2019 E
IGSF3     PN400103chr1:
117146504-117146504
GAexonicUnknownnonsynonymous SNVNM_001007237
NM_001542
c.C1366T
c.C1426T
p.R456C
p.R476C
26.28.361E-6Leblond2019 E
IGSF3     PN400103chr1:
117142868-117142868
CTexonicUnknownstopgainNM_001007237
NM_001542
c.G1724A
c.G1784A
p.W575X
p.W595X
35.0-Leblond2019 E
IGSF3     PN400103chr1:
117156585-117156585
GAexonicUnknownstopgainNM_001542
NM_001007237
c.C634T
c.C634T
p.Q212X
p.Q212X
37.08.27E-6Leblond2019 E
IGSF3     PN400103chr1:
117156459-117156459
CTexonicUnknownnonsynonymous SNVNM_001542
NM_001007237
c.G760A
c.G760A
p.D254N
p.D254N
31.0-Leblond2019 E
GXYLT1     PN400103chr12:
42499692-42499692
ATexonicUnknownstopgainNM_001099650
NM_173601
c.T699A
c.T792A
p.Y233X
p.Y264X
33.0-Leblond2019 E
DTX4     PN400103chr11:
58949308-58949308
CTexonicUnknownnonsynonymous SNVNM_015177c.C308Tp.T103M24.95.793E-5Leblond2019 E
GXYLT1     PN400103chr12:
42499739-42499739
CTexonicUnknownnonsynonymous SNVNM_001099650
NM_173601
c.G652A
c.G745A
p.E218K
p.E249K
36.0-Leblond2019 E
GXYLT1     PN400103chr12:
42499711-42499711
CAexonicUnknownnonsynonymous SNVNM_001099650
NM_173601
c.G680T
c.G773T
p.R227L
p.R258L
28.9-Leblond2019 E
LZTS2     PN400103chr10:
102765299-102765299
CTexonicUnknownnonsynonymous SNVNM_032429c.C1153Tp.R385W25.01.0E-4Leblond2019 E
MUC12     PN400103chr7:
100616336-100616336
GAintronicUnknown11.98-Leblond2019 E
CTBP2     PN400103chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400103chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
HERC2     PN400103chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
PABPC3     PN400103chr13:
25671456-25671456
CTexonicUnknownnonsynonymous SNVNM_030979c.C1120Tp.R374C14.86-Leblond2019 E
DMXL2     PN400103chr15:
51766634-51766636
CTGCexonicUnknownframeshift deletionNM_001174117
NM_001174116
NM_015263
c.5207_5208del
c.7118_7119del
c.7115_7116del
p.A1736fs
p.A2373fs
p.A2372fs
-4.507E-5Leblond2019 E
TYRO3     PN400103chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
PABPC3     PN400103chr13:
25671097-25671097
AATexonicUnknownframeshift insertionNM_030979c.761_762insTp.K254fs-0.1057Leblond2019 E
GOLGA3     PN400103chr12:
133378465-133378465
GAexonicUnknownnonsynonymous SNVNM_001172557
NM_005895
c.C1688T
c.C1688T
p.A563V
p.A563V
23.20.0062Leblond2019 E
PABPC3     PN400103chr13:
25671272-25671273
AGAexonicUnknownframeshift deletionNM_030979c.937delGp.A313fs--Leblond2019 E
PABPC3     PN400103chr13:
25671210-25671210
CTexonicUnknownstopgainNM_030979c.C874Tp.Q292X35.05.0E-4Leblond2019 E
IGSF3     PN400104chr1:
117146504-117146504
GAexonicUnknownnonsynonymous SNVNM_001007237
NM_001542
c.C1366T
c.C1426T
p.R456C
p.R476C
26.28.361E-6Leblond2019 E
IGSF3     PN400104chr1:
117142868-117142868
CTexonicUnknownstopgainNM_001007237
NM_001542
c.G1724A
c.G1784A
p.W575X
p.W595X
35.0-Leblond2019 E
IGSF3     PN400104chr1:
117156585-117156585
GAexonicUnknownstopgainNM_001542
NM_001007237
c.C634T
c.C634T
p.Q212X
p.Q212X
37.08.27E-6Leblond2019 E
IGSF3     PN400104chr1:
117156459-117156459
CTexonicUnknownnonsynonymous SNVNM_001542
NM_001007237
c.G760A
c.G760A
p.D254N
p.D254N
31.0-Leblond2019 E
PSMC5     PN400103chr17:
61907221-61907221
TAexonicUnknownstopgainNM_001199163
NM_002805
c.T152A
c.T176A
p.L51X
p.L59X
37.0-Leblond2019 E
HYDIN     PN400103chr16:
70977799-70977799
AATGTGGGGTexonicUnknownframeshift insertionNM_001270974c.6584_6585insACCCCACAp.S2195fs--Leblond2019 E
LRRC41     PN400104chr1:
46768880-46768880
CAexonicUnknownnonsynonymous SNVNM_006369c.G115Tp.G39C27.42.0E-4Leblond2019 E
CNN2     PN400103chr19:
1037756-1037756
GAexonicUnknownnonsynonymous SNVNM_201277
NM_001303499
NM_001303501
NM_004368
c.G670A
c.G754A
c.G850A
c.G787A
p.G224S
p.G252S
p.G284S
p.G263S
28.73.0E-4Leblond2019 E
OPRM1     PN400104chr6:
154412276-154412276
GAexonicUnknownnonsynonymous SNVNM_001285527
NM_001285528
NM_000914
NM_001008503
NM_001008504
NM_001008505
NM_001145280
NM_001145281
NM_001145282
NM_001145283
NM_001145284
NM_001145285
NM_001145286
NM_001145287
NM_001285523
NM_001285526
NM_001285524
NM_001145279
c.G533A
c.G533A
c.G833A
c.G833A
c.G833A
c.G833A
c.G533A
c.G590A
c.G833A
c.G833A
c.G833A
c.G833A
c.G833A
c.G533A
c.G833A
c.G533A
c.G1112A
c.G1112A
p.R178Q
p.R178Q
p.R278Q
p.R278Q
p.R278Q
p.R278Q
p.R178Q
p.R197Q
p.R278Q
p.R278Q
p.R278Q
p.R278Q
p.R278Q
p.R178Q
p.R278Q
p.R178Q
p.R371Q
p.R371Q
33.06.625E-5Leblond2019 E
SYNE1     PN400104chr6:
152464786-152464786
GAexonicUnknownnonsynonymous SNVNM_033071
NM_182961
c.C24947T
c.C25091T
p.P8316L
p.P8364L
34.00.0018Leblond2019 E
MUC3A     PN400104 Complex Event; expand row to view variants  Unknownframeshift deletionNM_005960
NM_005960
c.872delC
c.869_870del
p.T291fs
p.R290fs
-3.541E-5Leblond2019 E
Leblond2019 E
TRRAP     PN400104chr7:
98557015-98557015
CTexonicUnknownnonsynonymous SNVNM_003496
NM_001244580
c.C6316T
c.C6370T
p.R2106C
p.R2124C
33.01.0E-4Leblond2019 E
SCN9A     PN400104chr2:
167162344-167162344
CTexonicUnknownnonsynonymous SNVNM_002977c.G554Ap.R185H27.10.0033Leblond2019 E
NOTCH2NL     PN400104chr1:
145273366-145273366
CTexonicUnknownstopgainNM_203458c.C220Tp.R74X23.10.0873Leblond2019 E
AKAP12     PN400104chr6:
151672537-151672537
CTexonicUnknownnonsynonymous SNVNM_144497
NM_005100
c.C2717T
c.C3011T
p.S906L
p.S1004L
28.41.65E-5Leblond2019 E
IKZF2     PN400104chr2:
214012403-214012405
CAACintronicUnknown-0.2884Leblond2019 E
CTBP2     PN400104chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400104chr10:
126686659-126686659
GAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C2059T
c.C439T
c.C439T
c.C439T
c.C439T
p.R687W
p.R147W
p.R147W
p.R147W
p.R147W
24.9-Leblond2019 E
GXYLT1     PN400104chr12:
42499692-42499692
ATexonicUnknownstopgainNM_001099650
NM_173601
c.T699A
c.T792A
p.Y233X
p.Y264X
33.0-Leblond2019 E
CTBP2     PN400104chr10:
126692050-126692050
GAexonicUnknownstopgainNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.C1690T
c.C70T
c.C70T
c.C70T
c.C70T
p.Q564X
p.Q24X
p.Q24X
p.Q24X
p.Q24X
38.0-Leblond2019 E
MUC12     PN400104chr7:
100616336-100616336
GAintronicUnknown11.98-Leblond2019 E
MUC12     PN400104chr7:
100616185-100616185
CTintronicUnknown9.446-Leblond2019 E
PRSS3     PN400104chr9:
33794797-33794799
TGATexonicUnknownframeshift deletionNM_001197097c.9_10delp.M3fs-0.0398Leblond2019 E
ST18     PN400104chr8:
53030923-53030923
GTexonicUnknownnonsynonymous SNVNM_014682c.C2834Ap.A945E29.00.0036Leblond2019 E
PABPC3     PN400104chr13:
25671210-25671210
CTexonicUnknownstopgainNM_030979c.C874Tp.Q292X35.05.0E-4Leblond2019 E
PABPC3     PN400104chr13:
25671097-25671097
AATexonicUnknownframeshift insertionNM_030979c.761_762insTp.K254fs-0.1057Leblond2019 E
PABPC3     PN400104chr13:
25671456-25671456
CTexonicUnknownnonsynonymous SNVNM_030979c.C1120Tp.R374C14.86-Leblond2019 E
PABPC3     PN400104chr13:
25671272-25671273
AGAexonicUnknownframeshift deletionNM_030979c.937delGp.A313fs--Leblond2019 E
GXYLT1     PN400104chr12:
42499739-42499739
CTexonicUnknownnonsynonymous SNVNM_001099650
NM_173601
c.G652A
c.G745A
p.E218K
p.E249K
36.0-Leblond2019 E
GXYLT1     PN400104chr12:
42499711-42499711
CAexonicUnknownnonsynonymous SNVNM_001099650
NM_173601
c.G680T
c.G773T
p.R227L
p.R258L
28.9-Leblond2019 E
KRT1     PN400104chr12:
53070240-53070240
GAexonicUnknownnonsynonymous SNVNM_006121c.C1294Tp.R432C21.06.0E-4Leblond2019 E
GXYLT1     PN400104 Complex Event; expand row to view variants  Unknownframeshift insertion, nonframeshift deletionNM_001099650
NM_173601
NM_001099650
NM_173601
c.573_574insAA
c.666_667insAA
c.575_577del
c.668_670del
p.L192fs
p.L223fs
p.192_193del
p.223_224del
--Leblond2019 E
Leblond2019 E
IGSF3     PN400108chr1:
117142868-117142868
CTexonicUnknownstopgainNM_001007237
NM_001542
c.G1724A
c.G1784A
p.W575X
p.W595X
35.0-Leblond2019 E
GTPBP1     PN400104chr22:
39124008-39124008
CAexonicUnknownnonsynonymous SNVNM_004286c.C1558Ap.Q520K34.00.0045Leblond2019 E
IGSF3     PN400108chr1:
117156459-117156459
CTexonicUnknownnonsynonymous SNVNM_001542
NM_001007237
c.G760A
c.G760A
p.D254N
p.D254N
31.0-Leblond2019 E
IGSF3     PN400108chr1:
117146504-117146504
GAexonicUnknownnonsynonymous SNVNM_001007237
NM_001542
c.C1366T
c.C1426T
p.R456C
p.R476C
26.28.361E-6Leblond2019 E
HYDIN     PN400104chr16:
70977809-70977809
AATexonicUnknownframeshift insertionNM_001270974c.6574_6575insAp.L2192fs--Leblond2019 E
HYDIN     PN400104chr16:
70977799-70977799
AATGTGGGGTexonicUnknownframeshift insertionNM_001270974c.6584_6585insACCCCACAp.S2195fs--Leblond2019 E
LONP1     PN400104chr19:
5693470-5693470
CTexonicUnknownnonsynonymous SNVNM_001276480
NM_004793
NM_001276479
c.G1954A
c.G2542A
c.G2350A
p.A652T
p.A848T
p.A784T
26.62.0E-4Leblond2019 E
HYDIN     PN400104chr16:
70977811-70977811
CCGAATAATAATAexonicUnknownframeshift insertionNM_001270974c.6572_6573insTATTATTATTCp.W2191fs--Leblond2019 E
MUC12     PN400108chr7:
100616336-100616336
GAintronicUnknown11.98-Leblond2019 E
VPS41     PN400108chr7:
38807138-38807138
GAexonicUnknownnonsynonymous SNVNM_080631
NM_014396
c.C1171T
c.C1246T
p.R391C
p.R416C
17.080.0026Leblond2019 E
KMT2C     PN400108chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     PN400108chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
IKZF2     PN400108chr2:
214012403-214012405
CAACintronicUnknown-0.2884Leblond2019 E
IGSF3     PN400108chr1:
117156585-117156585
GAexonicUnknownstopgainNM_001542
NM_001007237
c.C634T
c.C634T
p.Q212X
p.Q212X
37.08.27E-6Leblond2019 E
ZNF608     PN400108chr5:
123980084-123980084
GAexonicUnknownnonsynonymous SNVNM_020747c.C3976Tp.R1326W19.091.647E-5Leblond2019 E
PRKCI     PN400108chr3:
170011257-170011257
GAexonicUnknownnonsynonymous SNVNM_002740c.G1378Ap.D460N34.0-Leblond2019 E
CTBP2     PN400108chr10:
126692022-126692023
CGCexonicUnknownframeshift deletionNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.1717delC
c.97delC
c.97delC
c.97delC
c.97delC
p.R573fs
p.R33fs
p.R33fs
p.R33fs
p.R33fs
--Leblond2019 E
CTBP2     PN400108chr10:
126686577-126686577
CAexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2141T
c.G521T
c.G521T
c.G521T
c.G521T
p.G714V
p.G174V
p.G174V
p.G174V
p.G174V
32.0-Leblond2019 E
GXYLT1     PN400108chr12:
42499711-42499711
CAexonicUnknownnonsynonymous SNVNM_001099650
NM_173601
c.G680T
c.G773T
p.R227L
p.R258L
28.9-Leblond2019 E
GXYLT1     PN400108chr12:
42499692-42499692
ATexonicUnknownstopgainNM_001099650
NM_173601
c.T699A
c.T792A
p.Y233X
p.Y264X
33.0-Leblond2019 E
CYHR1     PN400108chr8:
145689658-145689658
GGCexonicUnknownframeshift insertionNM_001129888
NM_032687
c.430dupG
c.430dupG
p.A144fs
p.A144fs
-0.0044Leblond2019 E
TTI2     PN400108chr8:
33361351-33361351
GAexonicUnknownnonsynonymous SNVNM_025115
NM_001102401
NM_001265581
c.C1030T
c.C1030T
c.C1030T
p.R344W
p.R344W
p.R344W
18.671.0E-4Leblond2019 E
CTBP2     PN400108chr10:
126686575-126686575
CTexonicUnknownnonsynonymous SNVNM_022802
NM_001083914
NM_001290214
NM_001290215
NM_001329
c.G2143A
c.G523A
c.G523A
c.G523A
c.G523A
p.A715T
p.A175T
p.A175T
p.A175T
p.A175T
35.0-Leblond2019 E
PRSS3     PN400108chr9:
33794797-33794799
TGATexonicUnknownframeshift deletionNM_001197097c.9_10delp.M3fs-0.0398Leblond2019 E
PABPC3     PN400108chr13:
25671272-25671273
AGAexonicUnknownframeshift deletionNM_030979c.937delGp.A313fs--Leblond2019 E
PABPC3     PN400108chr13:
25671210-25671210
CTexonicUnknownstopgainNM_030979c.C874Tp.Q292X35.05.0E-4Leblond2019 E
MRPL28     PN400108chr16:
419614-419614
CCCCGACCTGCTCTGCTCGCCTCCCCGACCTGCTCTGCTCGCCTCTintronicUnknown-0.0606Leblond2019 E
BRCA2     PN400108chr13:
32972626-32972626
ATexonicUnknownstopgainNM_000059c.A9976Tp.K3326X51.00.007Leblond2019 E
GXYLT1     PN400108 Complex Event; expand row to view variants  Unknownframeshift insertion, nonframeshift deletionNM_001099650
NM_173601
NM_001099650
NM_173601
c.573_574insAA
c.666_667insAA
c.575_577del
c.668_670del
p.L192fs
p.L223fs
p.192_193del
p.223_224del
--Leblond2019 E
Leblond2019 E
GXYLT1     PN400108chr12:
42499739-42499739
CTexonicUnknownnonsynonymous SNVNM_001099650
NM_173601
c.G652A
c.G745A
p.E218K
p.E249K
36.0-Leblond2019 E
PABPC3     PN400108chr13:
25671097-25671097
AATexonicUnknownframeshift insertionNM_030979c.761_762insTp.K254fs-0.1057Leblond2019 E
PAH     PN400108chr12:
103234271-103234271
GAexonicUnknownnonsynonymous SNVNM_000277c.C1222Tp.R408W19.027.0E-4Leblond2019 E
IGSF3     PN400111chr1:
117146504-117146504
GAexonicUnknownnonsynonymous SNVNM_001007237
NM_001542
c.C1366T
c.C1426T
p.R456C
p.R476C
26.28.361E-6Leblond2019 E
IGSF3     PN400111chr1:
117142868-117142868
CTexonicUnknownstopgainNM_001007237
NM_001542
c.G1724A
c.G1784A
p.W575X
p.W595X
35.0-Leblond2019 E
IGSF3     PN400111chr1:
117156585-117156585
GAexonicUnknownstopgainNM_001542
NM_001007237
c.C634T
c.C634T
p.Q212X
p.Q212X
37.08.27E-6Leblond2019 E
IGSF3     PN400111chr1:
117156459-117156459
CTexonicUnknownnonsynonymous SNVNM_001542
NM_001007237
c.G760A
c.G760A
p.D254N
p.D254N
31.0-Leblond2019 E
HYDIN     PN400108chr16:
70977799-70977799
AATGTGGGGTexonicUnknownframeshift insertionNM_001270974c.6584_6585insACCCCACAp.S2195fs--Leblond2019 E
HYDIN     PN400108chr16:
70902541-70902541
GAexonicUnknownnonsynonymous SNVNM_001270974c.C11242Tp.R3748C18.08.328E-6Leblond2019 E
PANK4     PN400111chr1:
2453133-2453134
CGCintronicUnknown--Leblond2019 E
DCAF15     PN400108chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
HLA-DRB1     PN400111chr6:
32549579-32549580
TGTexonicUnknownframeshift deletionNM_002124c.406delCp.Q136fs-0.0555Leblond2019 E
HLA-DRB1     PN400111chr6:
32549398-32549399
ACAexonicUnknownframeshift deletionNM_002124c.587delGp.S196fs-0.0066Leblond2019 E
MUC12     PN400111chr7:
100616185-100616185
CTintronicUnknown9.446-Leblond2019 E
HLA-DRB1     PN400111chr6:
32549584-32549584
CCTexonicUnknownframeshift insertionNM_002124c.401dupAp.K134fs-0.0561Leblond2019 E
TRAK1     PN400111chr3:
42244049-42244049
GAexonicUnknownnonsynonymous SNVNM_001265609
NM_001265610
NM_014965
NM_001042646
NM_001265608
c.G1327A
c.G1327A
c.G1375A
c.G1549A
c.G1549A
p.E443K
p.E443K
p.E459K
p.E517K
p.E517K
28.30.0023Leblond2019 E
SCN9A     PN400111chr2:
167162344-167162344
CTexonicUnknownnonsynonymous SNVNM_002977c.G554Ap.R185H27.10.0033